VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for Hepadnaviridae are 227
Results from 100 - 125

« previous12345678910next »
siRNA sequence "aaccucaauguuaguauuccu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aaccucaauguuaguauuccu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1026 " record
Length: 21
GC Content:33 %
Starting position: 133
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: siPORT
Incubation Time (Hours):72

Offtargets for "aaccucaauguuaguauuccu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16111658
Article:Stable inhibition of hepatitis B virus expression and replication by expressed siRNA.
Authors:Ren GL, Bai XF, Zhang Y, Chen HM, Huang CX, Wang PZ, Li GY, Zhang Y, Lian JQ.
Journal:Biochem Biophys Res Commun. 2005 Oct 7;335(4):1051-9.
Entrez:16111658

siRNA sequence "aacaucacaucaggauuccua" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aacaucacaucaggauuccua" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1028 " record
Length: 21
GC Content:38 %
Starting position: 1037
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: siPORT
Incubation Time (Hours):72

Offtargets for "aacaucacaucaggauuccua" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16111658
Article:Stable inhibition of hepatitis B virus expression and replication by expressed siRNA.
Authors:Ren GL, Bai XF, Zhang Y, Chen HM, Huang CX, Wang PZ, Li GY, Zhang Y, Lian JQ.
Journal:Biochem Biophys Res Commun. 2005 Oct 7;335(4):1051-9.
Entrez:16111658

siRNA sequence "aagaggacucuuggacucucu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aagaggacucuuggacucucu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1030 " record
Length: 21
GC Content:48 %
Starting position: 283
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: siPORT
Incubation Time (Hours):72

Offtargets for "aagaggacucuuggacucucu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16111658
Article:Stable inhibition of hepatitis B virus expression and replication by expressed siRNA.
Authors:Ren GL, Bai XF, Zhang Y, Chen HM, Huang CX, Wang PZ, Li GY, Zhang Y, Lian JQ.
Journal:Biochem Biophys Res Commun. 2005 Oct 7;335(4):1051-9.
Entrez:16111658

siRNA sequence "aacgaccgaccuugaggcaua" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aacgaccgaccuugaggcaua" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1031 " record
Length: 21
GC Content:52 %
Starting position: 312
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: siPORT
Incubation Time (Hours):72

Offtargets for "aacgaccgaccuugaggcaua" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16111658
Article:Stable inhibition of hepatitis B virus expression and replication by expressed siRNA.
Authors:Ren GL, Bai XF, Zhang Y, Chen HM, Huang CX, Wang PZ, Li GY, Zhang Y, Lian JQ.
Journal:Biochem Biophys Res Commun. 2005 Oct 7;335(4):1051-9.
Entrez:16111658

siRNA sequence "auuggucuguucaccagca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "auuggucuguucaccagca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1441 " record
Length: 19
GC Content:47 %
Starting position: 1790
Incubation Time (Hours):72

Offtargets for "auuggucuguucaccagca" siRNA in Human Genome sequences
See at Genbank
Pubmed:16443303
Article:Efficient inhibition of hepatitis B virus replication by small interfering RNAs targeted to the viral X gene in mice.
Authors:Shin D, Kim SI, Kim M, Park M.
Journal:Virus Res. 2006 Aug;119(2):146-53. Epub 2006 Jan 26.
Entrez:16443303

siRNA sequence "cccgucugugccuucucau" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "cccgucugugccuucucau" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1047 " record
Length: 19
GC Content:58 %
Starting position: 178
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "cccgucugugccuucucau" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18201553
Article:An accurate quantitative method for screening effective siRNA probes targeting a Hepatitis B virus transcript in single living cells.
Authors:Tong WP, Zhou Y, Wang X, Yang F, Wu KL, Wu J, Zhang Y.
Journal:Biochem Biophys Res Commun. 2008 Mar 21;367(4):866-73. Epub 2008 Jan 15.
Entrez:18201553

siRNA sequence "gugaacgcccaccgaaugu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gugaacgcccaccgaaugu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1053 " record
Length: 19
GC Content:58 %
Starting position: 250
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gugaacgcccaccgaaugu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18201553
Article:An accurate quantitative method for screening effective siRNA probes targeting a Hepatitis B virus transcript in single living cells.
Authors:Tong WP, Zhou Y, Wang X, Yang F, Wu KL, Wu J, Zhang Y.
Journal:Biochem Biophys Res Commun. 2008 Mar 21;367(4):866-73. Epub 2008 Jan 15.
Entrez:18201553

siRNA sequence "ccuccaaucacucaccaac" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ccuccaaucacucaccaac" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1157 " record
Length: 19
GC Content:53 %
Starting position: 324
Strain of Virus: ayr
GenBank Acc: X04615
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "ccuccaaucacucaccaac" siRNA in Human Genome sequences
See X04615 at Genbank
Pubmed:15316660
Article:Genome-wide expression profiling of RNA interference of hepatitis B virus gene expression and replication.
Authors:Li Y, Wasser S, Lim SG, Tan TM.
Journal:Cell Mol Life Sci. 2004 Aug;61(16):2113-24.
Entrez:15316660

siRNA sequence "cuaccgugugucuuggcca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "cuaccgugugucuuggcca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1073 " record
Length: 19
GC Content:58 %
Starting position: 290
Transfection Reagent: Polymer Polyethylenimine (PEI)
Incubation Time (Hours):48

Offtargets for "cuaccgugugucuuggcca" siRNA in Human Genome sequences
See at Genbank
Pubmed:15756649
Article:Stable inhibition of hepatitis B virus proteins by small interfering RNA expressed from viral vectors.
Authors:Moore MD, McGarvey MJ, Russell RA, Cullen BR, McClure MO.
Journal:J Gene Med. 2005 Jul;7(7):918-25.
Entrez:15756649

siRNA sequence "ggaaccucuauguaucccu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ggaaccucuauguaucccu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1008 " record
Length: 19
GC Content:47 %
Starting position: 542
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "ggaaccucuauguaucccu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18378325
Article:Inhibition of hepatitis B virus gene expression and replication by endoribonuclease-prepared siRNA.
Authors:Meng Z, Xu Y, Wu J, Tian Y, Kemper T, Bleekmann B, Roggendorf M, Yang D, Lu M.
Journal:J Virol Methods. 2008 Jun;150(1-2):27-33. Epub 2008 Apr 18.
Entrez:18378325

siRNA sequence "gccucaucuucuuguuggu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gccucaucuucuuguuggu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1117 " record
Length: 19
GC Content:47 %
Starting position: 424
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gccucaucuucuuguuggu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:19026173
Article:Optimal design and validation of antiviral siRNA for targeting hepatitis B virus.
Authors:Fu J, Tang ZM, Gao X, Zhao F, Zhong H, Wen MR, Sun X, Song HF, Qian XH.
Journal:Acta Pharmacol Sin. 2008 Dec;29(12):1522-8.
Entrez:19026173

siRNA sequence "gcucaguuuacuagugccauu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gcucaguuuacuagugccauu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1120 " record
Length: 21
GC Content:43 %
Starting position: 672
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gcucaguuuacuagugccauu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:19026173
Article:Optimal design and validation of antiviral siRNA for targeting hepatitis B virus.
Authors:Fu J, Tang ZM, Gao X, Zhao F, Zhong H, Wen MR, Sun X, Song HF, Qian XH.
Journal:Acta Pharmacol Sin. 2008 Dec;29(12):1522-8.
Entrez:19026173

siRNA sequence "gucuguacagcaucuugag" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gucuguacagcaucuugag" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1444 " record
Length: 19
GC Content:47 %
Starting position: 765
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Oligofectamine
Incubation Time (Hours):120

Offtargets for "gucuguacagcaucuugag" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:17245534
Article:Inhibition of hepatitis B virus replication by shRNAs in stably HBV expressed HEPG2 2.2.15 cell lines.
Authors:Kayhan H, Karatayli E, Turkyilmaz AR, Sahin F, Yurdaydin C, Bozdayi AM.
Journal:Arch Virol. 2007;152(5):871-9. Epub 2007 Jan 25.
Entrez:17245534

siRNA sequence "gauccugcgcgggacguccuu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gauccugcgcgggacguccuu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1476 " record
Length: 21
GC Content:67 %
Starting position: 1403
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):96

Offtargets for "gauccugcgcgggacguccuu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:15850463
Article:Inhibition of hepatitis B virus replication in 2.2.15 cells by expressed shRNA.
Authors:Ren XR, Zhou LJ, Luo GB, Lin B, Xu A.
Journal:J Viral Hepat. 2005 May;12(3):236-42.
Entrez:15850463

siRNA sequence "aauaccgcagagucuagacuc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aauaccgcagagucuagacuc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1114 " record
Length: 21
GC Content:48 %
Starting position: 237
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "aauaccgcagagucuagacuc" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:19026173
Article:Optimal design and validation of antiviral siRNA for targeting hepatitis B virus.
Authors:Fu J, Tang ZM, Gao X, Zhao F, Zhong H, Wen MR, Sun X, Song HF, Qian XH.
Journal:Acta Pharmacol Sin. 2008 Dec;29(12):1522-8.
Entrez:19026173

siRNA sequence "cgaccgaccuugaggcauacu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "cgaccgaccuugaggcauacu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1442 " record
Length: 21
GC Content:57 %
Starting position: 1689
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Oligofectamine
Incubation Time (Hours):120

Offtargets for "cgaccgaccuugaggcauacu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:17245534
Article:Inhibition of hepatitis B virus replication by shRNAs in stably HBV expressed HEPG2 2.2.15 cell lines.
Authors:Kayhan H, Karatayli E, Turkyilmaz AR, Sahin F, Yurdaydin C, Bozdayi AM.
Journal:Arch Virol. 2007;152(5):871-9. Epub 2007 Jan 25.
Entrez:17245534

siRNA sequence "ggcucaguuuacuagugcc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ggcucaguuuacuagugcc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1041 " record
Length: 19
GC Content:53 %
Starting position: 671
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "ggcucaguuuacuagugcc" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:17596868
Article:Targeted inhibition of HBV gene expression by single-chain antibody mediated small interfering RNA delivery.
Authors:Wen WH, Liu JY, Qin WJ, Zhao J, Wang T, Jia LT, Meng YL, Gao H, Xue CF, Jin BQ, Yao LB, Chen SY, Yang AG.
Journal:Hepatology. 2007 Jul;46(1):84-94.
Entrez:17596868

siRNA sequence "gugguggacuucucucaau" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gugguggacuucucucaau" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1020 " record
Length: 19
GC Content:47 %
Starting position: 256
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "gugguggacuucucucaau" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18274934
Article:siRNA pool targeting different sites of human hepatitis B surface antigen efficiently inhibits HBV infection.
Authors:Chen Y, Mahato RI.
Journal:J Drug Target. 2008 Feb;16(2):140-8.
Entrez:18274934

siRNA sequence "cgauccauacugcggaacu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "cgauccauacugcggaacu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1122 " record
Length: 19
GC Content:53 %
Starting position: 1263
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "cgauccauacugcggaacu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:19026173
Article:Optimal design and validation of antiviral siRNA for targeting hepatitis B virus.
Authors:Fu J, Tang ZM, Gao X, Zhao F, Zhong H, Wen MR, Sun X, Song HF, Qian XH.
Journal:Acta Pharmacol Sin. 2008 Dec;29(12):1522-8.
Entrez:19026173

siRNA sequence "aaauugcaccuguauucccau" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aaauugcaccuguauucccau" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1151 " record
Length: 21
GC Content:38 %
Starting position: 591
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24

Offtargets for "aaauugcaccuguauucccau" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16298967
Article:Inhibition of hepatitis B virus replication by various RNAi constructs and their pharmacodynamic properties.
Authors:Peng J, Zhao Y, Mai J, Pang WK, Wei X, Zhang P, Xu Y.
Journal:J Gen Virol. 2005 Dec;86(Pt 12):3227-34.
Entrez:16298967

siRNA sequence "aagaucucaaucucgggaauc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aagaucucaaucucgggaauc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1448 " record
Length: 21
GC Content:43 %
Transfection Reagent: Lipofectamine
Incubation Time (Hours):96

Offtargets for "aagaucucaaucucgggaauc" siRNA in Human Genome sequences
See at Genbank
Pubmed:18609708
Article:Combination of small interfering RNAs mediates greater suppression on hepatitis B virus cccDNA in HepG2.2.15 cells.
Authors:Xin XM, Li GQ, Jin YY, Zhuang M, Li D.
Journal:World J Gastroenterol. 2008 Jun 28;14(24):3849-54.
Entrez:18609708

siRNA sequence "gugguggacuucucucaau" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gugguggacuucucucaau" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1115 " record
Length: 19
GC Content:47 %
Starting position: 257
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gugguggacuucucucaau" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:19026173
Article:Optimal design and validation of antiviral siRNA for targeting hepatitis B virus.
Authors:Fu J, Tang ZM, Gao X, Zhao F, Zhong H, Wen MR, Sun X, Song HF, Qian XH.
Journal:Acta Pharmacol Sin. 2008 Dec;29(12):1522-8.
Entrez:19026173

siRNA sequence "agaccaccgugaacgccca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "agaccaccgugaacgccca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1051 " record
Length: 19
GC Content:63 %
Starting position: 242
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "agaccaccgugaacgccca" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18201553
Article:An accurate quantitative method for screening effective siRNA probes targeting a Hepatitis B virus transcript in single living cells.
Authors:Tong WP, Zhou Y, Wang X, Yang F, Wu KL, Wu J, Zhang Y.
Journal:Biochem Biophys Res Commun. 2008 Mar 21;367(4):866-73. Epub 2008 Jan 15.
Entrez:18201553

siRNA sequence "gucuguacagcaucuugag" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gucuguacagcaucuugag" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi2281 " record
Length: 19
GC Content:47 %
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: siPORTxp-1
Incubation Time (Hours):24

Offtargets for "gucuguacagcaucuugag" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:17926641
Article:The short hairpin RNA driven by polymerase II suppresses both wild-type and lamivudine-resistant hepatitis B virus strains.
Authors:Ren GL, Fang Y, Ma HH, Lei YF, Wang D, Xu MC, Wang PZ, Huang CX, Nie OH, Sun YT, Bai XF.
Journal:Antivir Ther. 2007;12(6):865-76.
Entrez:17926641

siRNA sequence "ucgcgggacguccuuuguuua" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ucgcgggacguccuuuguuua" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1033 " record
Length: 21
GC Content:52 %
Starting position: 1407
Transfection Reagent: siFECTamine
Incubation Time (Hours):96

Offtargets for "ucgcgggacguccuuuguuua" siRNA in Human Genome sequences
See at Genbank
Pubmed:19159285
Article:Controlling HBV replication in vivo by intravenous administration of triggered PEGylated siRNA-nanoparticles.
Authors:Carmona S, Jorgensen MR, Kolli S, Crowther C, Salazar FH, Marion PL, Fujino M, Natori Y, Thanou M, Arbuthnot P, Miller AD.
Journal:Mol Pharm. 2009 May-Jun;6(3):706-17.
Entrez:19159285


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1026	aaccucaauguuaguauuccu	Hepatitis B Virus [HBV]	P	HepG2.2.15	Protein	75	16111658	Blast SL	refseqs
virsi1028	aacaucacaucaggauuccua	Hepatitis B Virus [HBV]	P	HepG2.2.15	Protein	75	16111658	Blast SL	refseqs
virsi1030	aagaggacucuuggacucucu	Hepatitis B Virus [HBV]	P	HepG2.2.15	Protein	75	16111658	Blast SL	refseqs
virsi1031	aacgaccgaccuugaggcaua	Hepatitis B Virus [HBV]	P	HepG2.2.15	Protein	75	16111658	Blast SL	refseqs
virsi1441	auuggucuguucaccagca	Hepatitis B Virus [HBV]	X	Huh-7	Protein	75	16443303	Blast SL	refseqs
virsi1047	cccgucugugccuucucau	Hepatitis B Virus [HBV]	X	LinX	Protein	75	18201553	Blast SL	refseqs
virsi1053	gugaacgcccaccgaaugu	Hepatitis B Virus [HBV]	X	LinX	Protein	75	18201553	Blast SL	refseqs
virsi1157	ccuccaaucacucaccaac	Hepatitis B Virus [HBV]	S	HepG2.2.15	mRNA	75	15316660	Blast SL	refseqs
virsi1073	cuaccgugugucuuggcca	Hepatitis B Virus [HBV]	S	293T	Protein	74	15756649	Blast SL	refseqs
virsi1008	ggaaccucuauguaucccu	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	74	18378325	Blast SL	refseqs
virsi1117	gccucaucuucuuguuggu	Hepatitis B Virus [HBV]	P/S	HepG2.2.15	Protein	73	19026173	Blast SL	refseqs
virsi1120	gcucaguuuacuagugccauu	Hepatitis B Virus [HBV]	P/S	HepG2.2.15	Protein	73	19026173	Blast SL	refseqs
virsi1444	gucuguacagcaucuugag	Hepatitis B Virus [HBV]	S	HepG2.2.15	Viral Load	73	17245534	Blast SL	refseqs
virsi1476	gauccugcgcgggacguccuu	Hepatitis B Virus [HBV]	P/X	HepG2.2.15	Protein	73	15850463	Blast SL	refseqs
virsi1114	aauaccgcagagucuagacuc	Hepatitis B Virus [HBV]	P/S	HepG2.2.15	Protein	72	19026173	Blast SL	refseqs
virsi1442	cgaccgaccuugaggcauacu	Hepatitis B Virus [HBV]	X	HepG2.2.15	Viral Load	72	17245534	Blast SL	refseqs
virsi1041	ggcucaguuuacuagugcc	Hepatitis B Virus [HBV]	P/S	HepG2.2.15	Protein	72	17596868	Blast SL	refseqs
virsi1020	gugguggacuucucucaau	Hepatitis B Virus [HBV]	S	HepG2.2.15	mRNA	72	18274934	Blast SL	refseqs
virsi1122	cgauccauacugcggaacu	Hepatitis B Virus [HBV]	P	HepG2.2.15	Protein	71	19026173	Blast SL	refseqs
virsi1151	aaauugcaccuguauucccau	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	71	16298967	Blast SL	refseqs
virsi1448	aagaucucaaucucgggaauc	Hepatitis B Virus [HBV]	NLS	HepG2.2.15	Protein	71	18609708	Blast SL	refseqs
virsi1115	gugguggacuucucucaau	Hepatitis B Virus [HBV]	P/S	HepG2.2.15	Protein	70	19026173	Blast SL	refseqs
virsi1051	agaccaccgugaacgccca	Hepatitis B Virus [HBV]	X	LinX	Protein	70	18201553	Blast SL	refseqs
virsi2281	gucuguacagcaucuugag	Hepatitis B Virus [HBV]	ORF-S	HepG2.2.15	RNA	70	17926641	Blast SL	refseqs
virsi1033	ucgcgggacguccuuuguuua	Hepatitis B Virus [HBV]	HBeAg	Huh-7	Protein	70	19159285	Blast SL	refseqs



« previous12345678910next »

: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm