VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for Hepadnaviridae are 227
Results from 125 - 150

« previous12345678910next »
siRNA sequence "aagucuguacagcaucuugag" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aagucuguacagcaucuugag" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1454 " record
Length: 21
GC Content:43 %
GenBank Acc: EF103275
Transfection Reagent: Lipofectamine
Incubation Time (Hours):168

Offtargets for "aagucuguacagcaucuugag" siRNA in Human Genome sequences
See EF103275 at Genbank
Pubmed:18474581
Article:Long-term suppression of hepatitis B virus replication by short hairpin RNA expression using the scaffold/matrix attachment region-based replicating vector system pEPI-1.
Authors:Jenke AC, Wilhelm AD, Orth V, Lipps HJ, Protzer U, Wirth S.
Journal:Antimicrob Agents Chemother. 2008 Jul;52(7):2355-9. Epub 2008 May 12.
Entrez:18474581

siRNA sequence "uccccgucugugccuucucaucugc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "uccccgucugugccuucucaucugc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1473 " record
Length: 25
GC Content:60 %
Incubation Time (Hours):192

Offtargets for "uccccgucugugccuucucaucugc" siRNA in Human Genome sequences
See at Genbank
Pubmed:12740585
Article:Inhibition of hepatitis B virus in mice by RNA interference.
Authors:McCaffrey AP, Nakai H, Pandey K, Huang Z, Salazar FH, Xu H, Wieland SF, Marion PL, Kay MA.
Journal:Nat Biotechnol. 2003 Jun;21(6):639-44. Epub 2003 May 12.
Entrez:12740585

siRNA sequence "aaagaucaauuauuaacuaaa" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aaagaucaauuauuaacuaaa" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1670 " record
Length: 21
GC Content:14 %
Starting position: 1827
GenBank Acc: M19183
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "aaagaucaauuauuaacuaaa" siRNA in Human Genome sequences
See M19183 at Genbank
Pubmed:19064272
Article:Inhibition of woodchuck hepatitis virus gene expression in primary hepatocytes by siRNA enhances the cellular gene expression.
Authors:Meng Z, Qiu S, Zhang X, Wu J, Schreiter T, Xu Y, Yang D, Roggendorf M, Schlaak J, Lu M.
Journal:Virology. 2009 Feb 5;384(1):88-96. Epub 2008 Dec 6.
Entrez:19064272

siRNA sequence "gaagaacucccucgccucg" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gaagaacucccucgccucg" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1138 " record
Length: 19
GC Content:63 %
Starting position: 2373
Strain of Virus: adr
GenBank Acc: AF286594
Transfection Reagent: FuGENE
Incubation Time (Hours):72

Offtargets for "gaagaacucccucgccucg" siRNA in Human Genome sequences
See AF286594 at Genbank
Pubmed:15378775
Article:siRNA-mediated inhibition of HBV replication and expression.
Authors:Zhang XN, Xiong W, Wang JD, Hu YW, Xiang L, Yuan ZH.
Journal:World J Gastroenterol. 2004 Oct 15;10(20):2967-71.
Entrez:15378775

siRNA sequence "cgcuucaccucugcacguc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "cgcuucaccucugcacguc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1049 " record
Length: 19
GC Content:63 %
Starting position: 217
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "cgcuucaccucugcacguc" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18201553
Article:An accurate quantitative method for screening effective siRNA probes targeting a Hepatitis B virus transcript in single living cells.
Authors:Tong WP, Zhou Y, Wang X, Yang F, Wu KL, Wu J, Zhang Y.
Journal:Biochem Biophys Res Commun. 2008 Mar 21;367(4):866-73. Epub 2008 Jan 15.
Entrez:18201553

siRNA sequence "ccuagaagaagaacucccucgccuc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ccuagaagaagaacucccucgccuc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1445 " record
Length: 25
GC Content:56 %
Incubation Time (Hours):168

Offtargets for "ccuagaagaagaacucccucgccuc" siRNA in Human Genome sequences
See at Genbank
Pubmed:19804649
Article:Hepatitis B virus inhibition in mice by lentiviral vector mediated short hairpin RNA.
Authors:Deng L, Li G, Xi L, Yin A, Gao Y, You W, Wang X, Sun B.
Journal:BMC Gastroenterol. 2009 Oct 6;9:73.
Entrez:19804649

siRNA sequence "gaauccucacaauaccgca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gaauccucacaauaccgca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1070 " record
Length: 19
GC Content:47 %
Starting position: 227
Transfection Reagent: Polymer Polyethylenimine (PEI)
Incubation Time (Hours):48

Offtargets for "gaauccucacaauaccgca" siRNA in Human Genome sequences
See at Genbank
Pubmed:15756649
Article:Stable inhibition of hepatitis B virus proteins by small interfering RNA expressed from viral vectors.
Authors:Moore MD, McGarvey MJ, Russell RA, Cullen BR, McClure MO.
Journal:J Gene Med. 2005 Jul;7(7):918-25.
Entrez:15756649

siRNA sequence "ucucgggaaucucaauguu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ucucgggaaucucaauguu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1676 " record
Length: 19
GC Content:42 %
Starting position: 2432
GenBank Acc: FR714498
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "ucucgggaaucucaauguu" siRNA in Human Genome sequences
See FR714498 at Genbank
Pubmed:18685862
Article:Inhibition of hepatitis B virus replication by small interference RNA induces expression of MICA in HepG2.2.15 cells.
Authors:Tang KF, Chen M, Xie J, Song GB, Shi YS, Liu Q, Mei ZC, Steinle A, Ren H.
Journal:Med Microbiol Immunol. 2009 Feb;198(1):27-32. Epub 2008 Aug 7.
Entrez:18685862

siRNA sequence "gcugugccuuggguggcuu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gcugugccuuggguggcuu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1095 " record
Length: 19
GC Content:63 %
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Oligofectamine
Incubation Time (Hours):168

Offtargets for "gcugugccuuggguggcuu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:14512871
Article:Inhibition of HBV replication by siRNA in a stable HBV-producing cell line.
Authors:Konishi M, Wu CH, Wu GY.
Journal:Hepatology. 2003 Oct;38(4):842-50.
Entrez:14512871

siRNA sequence "ggaggcuguaggcauaaauuggu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ggaggcuguaggcauaaauuggu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1478 " record
Length: 23
GC Content:48 %
Starting position: 1778
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):96

Offtargets for "ggaggcuguaggcauaaauuggu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:15850463
Article:Inhibition of hepatitis B virus replication in 2.2.15 cells by expressed shRNA.
Authors:Ren XR, Zhou LJ, Luo GB, Lin B, Xu A.
Journal:J Viral Hepat. 2005 May;12(3):236-42.
Entrez:15850463

siRNA sequence "ggcugcuaugccucaucuucu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ggcugcuaugccucaucuucu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1080 " record
Length: 21
GC Content:52 %
Transfection Reagent: Effectene
Incubation Time (Hours):120

Offtargets for "ggcugcuaugccucaucuucu" siRNA in Human Genome sequences
See at Genbank
Pubmed:16254373
Article:Genomic analysis of anti-hepatitis B virus (HBV) activity by small interfering RNA and lamivudine in stable HBV-producing cells.
Authors:Guo Y, Guo H, Zhang L, Xie H, Zhao X, Wang F, Li Z, Wang Y, Ma S, Tao J, Wang W, Zhou Y, Yang W, Cheng J.
Journal:J Virol. 2005 Nov;79(22):14392-403.
Entrez:16254373

siRNA sequence "gcaaugucaacgaccgacc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gcaaugucaacgaccgacc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi2014 " record
Length: 19
GC Content:58 %
Starting position: 1679
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Sofast
Incubation Time (Hours):48

Offtargets for "gcaaugucaacgaccgacc" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16022904
Article:Inhibition of Hepatitis B virus gene expression by single and dual small interfering RNA treatment.
Authors:Wu KL, Zhang X, Zhang J, Yang Y, Mu YX, Liu M, Lu L, Li Y, Zhu Y, Wu J.
Journal:Virus Res. 2005 Sep;112(1-2):100-7. Epub 2005 Apr 26.
Entrez:16022904

siRNA sequence "acgacagucaauugcagacaa" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "acgacagucaauugcagacaa" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1668 " record
Length: 21
GC Content:43 %
Starting position: 632
GenBank Acc: M19183
Transfection Reagent: Lipofectamine
Incubation Time (Hours):72

Offtargets for "acgacagucaauugcagacaa" siRNA in Human Genome sequences
See M19183 at Genbank
Pubmed:19064272
Article:Inhibition of woodchuck hepatitis virus gene expression in primary hepatocytes by siRNA enhances the cellular gene expression.
Authors:Meng Z, Qiu S, Zhang X, Wu J, Schreiter T, Xu Y, Yang D, Roggendorf M, Schlaak J, Lu M.
Journal:Virology. 2009 Feb 5;384(1):88-96. Epub 2008 Dec 6.
Entrez:19064272

siRNA sequence "aauguugcccaaggucuuaca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aauguugcccaaggucuuaca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1029 " record
Length: 21
GC Content:43 %
Starting position: 261
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: siPORT
Incubation Time (Hours):72

Offtargets for "aauguugcccaaggucuuaca" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16111658
Article:Stable inhibition of hepatitis B virus expression and replication by expressed siRNA.
Authors:Ren GL, Bai XF, Zhang Y, Chen HM, Huang CX, Wang PZ, Li GY, Zhang Y, Lian JQ.
Journal:Biochem Biophys Res Commun. 2005 Oct 7;335(4):1051-9.
Entrez:16111658

siRNA sequence "gcucaaggaaccucuaugu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gcucaaggaaccucuaugu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1119 " record
Length: 19
GC Content:47 %
Starting position: 537
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gcucaaggaaccucuaugu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:19026173
Article:Optimal design and validation of antiviral siRNA for targeting hepatitis B virus.
Authors:Fu J, Tang ZM, Gao X, Zhao F, Zhong H, Wen MR, Sun X, Song HF, Qian XH.
Journal:Acta Pharmacol Sin. 2008 Dec;29(12):1522-8.
Entrez:19026173

siRNA sequence "aaggaaccucuauguaucccu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aaggaaccucuauguaucccu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1150 " record
Length: 21
GC Content:43 %
Starting position: 542
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24

Offtargets for "aaggaaccucuauguaucccu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16298967
Article:Inhibition of hepatitis B virus replication by various RNAi constructs and their pharmacodynamic properties.
Authors:Peng J, Zhao Y, Mai J, Pang WK, Wei X, Zhang P, Xu Y.
Journal:J Gen Virol. 2005 Dec;86(Pt 12):3227-34.
Entrez:16298967

siRNA sequence "ugaucuuuguacuaggagg" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ugaucuuuguacuaggagg" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1440 " record
Length: 19
GC Content:42 %
Starting position: 1759
Incubation Time (Hours):72

Offtargets for "ugaucuuuguacuaggagg" siRNA in Human Genome sequences
See at Genbank
Pubmed:16443303
Article:Efficient inhibition of hepatitis B virus replication by small interfering RNAs targeted to the viral X gene in mice.
Authors:Shin D, Kim SI, Kim M, Park M.
Journal:Virus Res. 2006 Aug;119(2):146-53. Epub 2006 Jan 26.
Entrez:16443303

siRNA sequence "gggaggaguugggggagga" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gggaggaguugggggagga" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1055 " record
Length: 19
GC Content:68 %
Starting position: 362
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gggaggaguugggggagga" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18201553
Article:An accurate quantitative method for screening effective siRNA probes targeting a Hepatitis B virus transcript in single living cells.
Authors:Tong WP, Zhou Y, Wang X, Yang F, Wu KL, Wu J, Zhang Y.
Journal:Biochem Biophys Res Commun. 2008 Mar 21;367(4):866-73. Epub 2008 Jan 15.
Entrez:18201553

siRNA sequence "caguccccaaccuccaaucacu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "caguccccaaccuccaaucacu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1663 " record
Length: 22
GC Content:55 %
Starting position: 316
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "caguccccaaccuccaaucacu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:15387899
Article:[Establish a screening system for selection of mRNA target sites for HBsAg to construct siRNA with shRNA].
Authors:Yang ZG, Chen Z, Xu N, Ni Q, Pan XC, Jin HY, Li MW.
Journal:Zhonghua Gan Zang Bing Za Zhi. 2004 Sep;12(9):515-8. Chinese.
Entrez:15387899

siRNA sequence "ggucuuacauaagaggacu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ggucuuacauaagaggacu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1159 " record
Length: 19
GC Content:42 %
Starting position: 1649
Strain of Virus: adw
GenBank Acc: HPBadwZCG
Incubation Time (Hours):72

Offtargets for "ggucuuacauaagaggacu" siRNA in Human Genome sequences
See HPBadwZCG at Genbank
Pubmed:12668968
Article:Inhibition of hepatitis B virus expression and replication by RNA interference.
Authors:Shlomai A, Shaul Y.
Journal:Hepatology. 2003 Apr;37(4):764-70.
Entrez:12668968

siRNA sequence "gccuccaagcugugccuuggg" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gccuccaagcugugccuuggg" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1137 " record
Length: 21
GC Content:67 %
Starting position: 1868
Strain of Virus: adr
GenBank Acc: AF286594
Transfection Reagent: FuGENE
Incubation Time (Hours):72

Offtargets for "gccuccaagcugugccuuggg" siRNA in Human Genome sequences
See AF286594 at Genbank
Pubmed:15378775
Article:siRNA-mediated inhibition of HBV replication and expression.
Authors:Zhang XN, Xiong W, Wang JD, Hu YW, Xiang L, Yuan ZH.
Journal:World J Gastroenterol. 2004 Oct 15;10(20):2967-71.
Entrez:15378775

siRNA sequence "caacacauagcgccucauu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "caacacauagcgccucauu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1113 " record
Length: 19
GC Content:47 %
Starting position: 2793
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "caacacauagcgccucauu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:19026173
Article:Optimal design and validation of antiviral siRNA for targeting hepatitis B virus.
Authors:Fu J, Tang ZM, Gao X, Zhao F, Zhong H, Wen MR, Sun X, Song HF, Qian XH.
Journal:Acta Pharmacol Sin. 2008 Dec;29(12):1522-8.
Entrez:19026173

siRNA sequence "gccaaaauucgcaguccc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gccaaaauucgcaguccc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi2012 " record
Length: 18
GC Content:56 %
Starting position: 303
Strain of Virus: ayw
GenBank Acc: AB048705
Transfection Reagent: Sofast
Incubation Time (Hours):48

Offtargets for "gccaaaauucgcaguccc" siRNA in Human Genome sequences
See AB048705 at Genbank
Pubmed:16022904
Article:Inhibition of Hepatitis B virus gene expression by single and dual small interfering RNA treatment.
Authors:Wu KL, Zhang X, Zhang J, Yang Y, Mu YX, Liu M, Lu L, Li Y, Zhu Y, Wu J.
Journal:Virus Res. 2005 Sep;112(1-2):100-7. Epub 2005 Apr 26.
Entrez:16022904

siRNA sequence "gauuccuaggaccccuucucg" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gauuccuaggaccccuucucg" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1477 " record
Length: 21
GC Content:57 %
Starting position: 176
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):96

Offtargets for "gauuccuaggaccccuucucg" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:15850463
Article:Inhibition of hepatitis B virus replication in 2.2.15 cells by expressed shRNA.
Authors:Ren XR, Zhou LJ, Luo GB, Lin B, Xu A.
Journal:J Viral Hepat. 2005 May;12(3):236-42.
Entrez:15850463

siRNA sequence "uuggucugcgcaccaucauca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "uuggucugcgcaccaucauca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1037 " record
Length: 21
GC Content:52 %
Starting position: 1794
Transfection Reagent: siFECTamine
Incubation Time (Hours):96

Offtargets for "uuggucugcgcaccaucauca" siRNA in Human Genome sequences
See at Genbank
Pubmed:19159285
Article:Controlling HBV replication in vivo by intravenous administration of triggered PEGylated siRNA-nanoparticles.
Authors:Carmona S, Jorgensen MR, Kolli S, Crowther C, Salazar FH, Marion PL, Fujino M, Natori Y, Thanou M, Arbuthnot P, Miller AD.
Journal:Mol Pharm. 2009 May-Jun;6(3):706-17.
Entrez:19159285


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1454	aagucuguacagcaucuugag	Hepatitis B Virus [HBV]	ORF	HepG2.2.15	Protein	70	18474581	Blast SL	refseqs
virsi1473	uccccgucugugccuucucaucugc	Hepatitis B Virus [HBV]	X	Huh-7	Protein	70	12740585	Blast SL	refseqs
virsi1670	aaagaucaauuauuaacuaaa	Hepatitis B Virus [HBV]	X	BHK/HepG2	RNA	69	19064272	Blast SL	refseqs
virsi1138	gaagaacucccucgccucg	Hepatitis B Virus [HBV]	C	Huh-7	Protein	69	15378775	Blast SL	refseqs
virsi1049	cgcuucaccucugcacguc	Hepatitis B Virus [HBV]	X	LinX	Protein	68	18201553	Blast SL	refseqs
virsi1445	ccuagaagaagaacucccucgccuc	Hepatitis B Virus [HBV]	P	293T	Protein	68	19804649	Blast SL	refseqs
virsi1070	gaauccucacaauaccgca	Hepatitis B Virus [HBV]	S	293T	Protein	68	15756649	Blast SL	refseqs
virsi1676	ucucgggaaucucaauguu	Hepatitis B Virus [HBV]	C	HepG2.2.15	RNA	67	18685862	Blast SL	refseqs
virsi1095	gcugugccuuggguggcuu	Hepatitis B Virus [HBV]	C	HepG2.2.15	Protein	67	14512871	Blast SL	refseqs
virsi1478	ggaggcuguaggcauaaauuggu	Hepatitis B Virus [HBV]	X	HepG2.2.15	Protein	67	15850463	Blast SL	refseqs
virsi1080	ggcugcuaugccucaucuucu	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	67	16254373	Blast SL	refseqs
virsi2014	gcaaugucaacgaccgacc	Hepatitis B Virus [HBV]	X	HepG2.2.15	Protein	65	16022904	Blast SL	refseqs
virsi1668	acgacagucaauugcagacaa	Hepatitis B Virus [HBV]	S	BHK/HepG2	RNA	65	19064272	Blast SL	refseqs
virsi1029	aauguugcccaaggucuuaca	Hepatitis B Virus [HBV]	P	HepG2.2.15	Protein	65	16111658	Blast SL	refseqs
virsi1119	gcucaaggaaccucuaugu	Hepatitis B Virus [HBV]	P/S	HepG2.2.15	Protein	65	19026173	Blast SL	refseqs
virsi1150	aaggaaccucuauguaucccu	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	65	16298967	Blast SL	refseqs
virsi1440	ugaucuuuguacuaggagg	Hepatitis B Virus [HBV]	X	Huh-7	Protein	65	16443303	Blast SL	refseqs
virsi1055	gggaggaguugggggagga	Hepatitis B Virus [HBV]	X	LinX	Protein	64	18201553	Blast SL	refseqs
virsi1663	caguccccaaccuccaaucacu	Hepatitis B Virus [HBV]	S	HeLa	Protein	63	15387899	Blast SL	refseqs
virsi1159	ggucuuacauaagaggacu	Hepatitis B Virus [HBV]	X	Huh-7	Protein	63	12668968	Blast SL	refseqs
virsi1137	gccuccaagcugugccuuggg	Hepatitis B Virus [HBV]	C	Huh-7	Protein	63	15378775	Blast SL	refseqs
virsi1113	caacacauagcgccucauu	Hepatitis B Virus [HBV]	P	HepG2.2.15	Protein	61	19026173	Blast SL	refseqs
virsi2012	gccaaaauucgcaguccc	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	60	16022904	Blast SL	refseqs
virsi1477	gauuccuaggaccccuucucg	Hepatitis B Virus [HBV]	P/S	HepG2.2.15	Protein	60	15850463	Blast SL	refseqs
virsi1037	uuggucugcgcaccaucauca	Hepatitis B Virus [HBV]	HBeAg	Huh-7	Protein	60	19159285	Blast SL	refseqs



« previous12345678910next »

: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm