VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for Hepadnaviridae are 227
Results from 150 - 175

« previous12345678910next »
siRNA sequence "aaccuccaaucacucaccaac" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aaccuccaaucacucaccaac" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1021 " record
Length: 21
GC Content:48 %
Starting position: 322
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "aaccuccaaucacucaccaac" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18274934
Article:siRNA pool targeting different sites of human hepatitis B surface antigen efficiently inhibits HBV infection.
Authors:Chen Y, Mahato RI.
Journal:J Drug Target. 2008 Feb;16(2):140-8.
Entrez:18274934

siRNA sequence "gaccuugaggcauacuuca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gaccuugaggcauacuuca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1126 " record
Length: 19
GC Content:47 %
Starting position: 1694
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gaccuugaggcauacuuca" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:19026173
Article:Optimal design and validation of antiviral siRNA for targeting hepatitis B virus.
Authors:Fu J, Tang ZM, Gao X, Zhao F, Zhong H, Wen MR, Sun X, Song HF, Qian XH.
Journal:Acta Pharmacol Sin. 2008 Dec;29(12):1522-8.
Entrez:19026173

siRNA sequence "ccucuuguccuccaauuug" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ccucuuguccuccaauuug" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1088 " record
Length: 19
GC Content:47 %
Starting position: 342
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72

Offtargets for "ccucuuguccuccaauuug" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:15754419
Article:Combination of small interfering RNAs mediates greater inhibition of human hepatitis B virus replication and antigen expression.
Authors:Chen Z, Xu ZF, Ye JJ, Yao HP, Zheng S, Ding JY.
Journal:J Zhejiang Univ Sci B. 2005 Apr;6(4):236-41.
Entrez:15754419

siRNA sequence "cagguccccuagaagaagaac" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "cagguccccuagaagaagaac" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1449 " record
Length: 21
GC Content:52 %
Transfection Reagent: Lipofectamine
Incubation Time (Hours):96

Offtargets for "cagguccccuagaagaagaac" siRNA in Human Genome sequences
See at Genbank
Pubmed:18609708
Article:Combination of small interfering RNAs mediates greater suppression on hepatitis B virus cccDNA in HepG2.2.15 cells.
Authors:Xin XM, Li GQ, Jin YY, Zhuang M, Li D.
Journal:World J Gastroenterol. 2008 Jun 28;14(24):3849-54.
Entrez:18609708

siRNA sequence "uucaccucugccuaaucau" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "uucaccucugccuaaucau" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1128 " record
Length: 19
GC Content:42 %
Starting position: 1826
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "uucaccucugccuaaucau" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:19026173
Article:Optimal design and validation of antiviral siRNA for targeting hepatitis B virus.
Authors:Fu J, Tang ZM, Gao X, Zhao F, Zhong H, Wen MR, Sun X, Song HF, Qian XH.
Journal:Acta Pharmacol Sin. 2008 Dec;29(12):1522-8.
Entrez:19026173

siRNA sequence "cccuaucuuaucaacacuuccggaa" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "cccuaucuuaucaacacuuccggaa" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1451 " record
Length: 25
GC Content:44 %
Starting position: 2311
Transfection Reagent: Lipofectamine 2000

Offtargets for "cccuaucuuaucaacacuuccggaa" siRNA in Human Genome sequences
See at Genbank
Pubmed:17588164
Article:Two approaches to construct mammalian expression vector of shRNA to reduce expression and replication of HBV in vitro.
Authors:Zhang HB, Wu J, Xian J, Pei L, Wang J.
Journal:Mol Biol Rep. 2008 Sep;35(3):465-72. Epub 2007 Jun 22.
Entrez:17588164

siRNA sequence "ggacauugacccguauaaagac" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ggacauugacccguauaaagac" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1455 " record
Length: 22
GC Content:45 %
GenBank Acc: EF103275
Transfection Reagent: Lipofectamine
Incubation Time (Hours):168

Offtargets for "ggacauugacccguauaaagac" siRNA in Human Genome sequences
See EF103275 at Genbank
Pubmed:18474581
Article:Long-term suppression of hepatitis B virus replication by short hairpin RNA expression using the scaffold/matrix attachment region-based replicating vector system pEPI-1.
Authors:Jenke AC, Wilhelm AD, Orth V, Lipps HJ, Protzer U, Wirth S.
Journal:Antimicrob Agents Chemother. 2008 Jul;52(7):2355-9. Epub 2008 May 12.
Entrez:18474581

siRNA sequence "gguauguugcccguuuguc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gguauguugcccguuuguc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1156 " record
Length: 19
GC Content:53 %
Starting position: 458
Strain of Virus: ayr
GenBank Acc: X04615
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gguauguugcccguuuguc" siRNA in Human Genome sequences
See X04615 at Genbank
Pubmed:15316660
Article:Genome-wide expression profiling of RNA interference of hepatitis B virus gene expression and replication.
Authors:Li Y, Wasser S, Lim SG, Tan TM.
Journal:Cell Mol Life Sci. 2004 Aug;61(16):2113-24.
Entrez:15316660

siRNA sequence "gccucaucuucuuguuggu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gccucaucuucuuguuggu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1022 " record
Length: 19
GC Content:47 %
Starting position: 423
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "gccucaucuucuuguuggu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18274934
Article:siRNA pool targeting different sites of human hepatitis B surface antigen efficiently inhibits HBV infection.
Authors:Chen Y, Mahato RI.
Journal:J Drug Target. 2008 Feb;16(2):140-8.
Entrez:18274934

siRNA sequence "gggaccaugcagaaccugcacgauu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gggaccaugcagaaccugcacgauu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1450 " record
Length: 25
GC Content:56 %
Starting position: 508
Transfection Reagent: Lipofectamine 2000

Offtargets for "gggaccaugcagaaccugcacgauu" siRNA in Human Genome sequences
See at Genbank
Pubmed:17588164
Article:Two approaches to construct mammalian expression vector of shRNA to reduce expression and replication of HBV in vitro.
Authors:Zhang HB, Wu J, Xian J, Pei L, Wang J.
Journal:Mol Biol Rep. 2008 Sep;35(3):465-72. Epub 2007 Jun 22.
Entrez:17588164

siRNA sequence "guguuugcugacgcaaccc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "guguuugcugacgcaaccc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1091 " record
Length: 19
GC Content:58 %
Starting position: 1180
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72

Offtargets for "guguuugcugacgcaaccc" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:15754419
Article:Combination of small interfering RNAs mediates greater inhibition of human hepatitis B virus replication and antigen expression.
Authors:Chen Z, Xu ZF, Ye JJ, Yao HP, Zheng S, Ding JY.
Journal:J Zhejiang Univ Sci B. 2005 Apr;6(4):236-41.
Entrez:15754419

siRNA sequence "auguugcccguuuguccucua" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "auguugcccguuuguccucua" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1118 " record
Length: 21
GC Content:48 %
Starting position: 463
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "auguugcccguuuguccucua" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:19026173
Article:Optimal design and validation of antiviral siRNA for targeting hepatitis B virus.
Authors:Fu J, Tang ZM, Gao X, Zhao F, Zhong H, Wen MR, Sun X, Song HF, Qian XH.
Journal:Acta Pharmacol Sin. 2008 Dec;29(12):1522-8.
Entrez:19026173

siRNA sequence "ggcuggcauucuauauaagagagaa" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ggcuggcauucuauauaagagagaa" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1452 " record
Length: 25
GC Content:40 %
Starting position: 2765
Transfection Reagent: Lipofectamine 2000

Offtargets for "ggcuggcauucuauauaagagagaa" siRNA in Human Genome sequences
See at Genbank
Pubmed:17588164
Article:Two approaches to construct mammalian expression vector of shRNA to reduce expression and replication of HBV in vitro.
Authors:Zhang HB, Wu J, Xian J, Pei L, Wang J.
Journal:Mol Biol Rep. 2008 Sep;35(3):465-72. Epub 2007 Jun 22.
Entrez:17588164

siRNA sequence "ucauguccuacuguucaagu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ucauguccuacuguucaagu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1457 " record
Length: 20
GC Content:40 %
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "ucauguccuacuguucaagu" siRNA in Human Genome sequences
See at Genbank
Pubmed:16929350
Article:Long-term inhibition of hepatitis B virus in transgenic mice by double-stranded adeno-associated virus 8-delivered short hairpin RNA.
Authors:Chen CC, Ko TM, Ma HI, Wu HL, Xiao X, Li J, Chang CM, Wu PY, Chen CH, Han JM, Yu CP, Jeng KS, Hu CP, Tao MH.
Journal:Gene Ther. 2007 Jan;14(1):11-9. Epub 2006 Aug 24.
Entrez:16929350

siRNA sequence "acauaagaggacucuugga" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "acauaagaggacucuugga" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1964 " record
Length: 19
GC Content:42 %
Starting position: 1652
GenBank Acc: GU563562
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48

Offtargets for "acauaagaggacucuugga" siRNA in Human Genome sequences
See GU563562 at Genbank
Pubmed:20538734
Article:Effects of the TP53 p.R249S mutant on proliferation and clonogenic properties in human hepatocellular carcinoma cell lines: interaction with hepatitis B virus X protein.
Authors:Gouas DA, Shi H, Hautefeuille AH, Ortiz-Cuaran SL, Legros PC, Szymanska KJ, Galy O, Egevad LA, Abedi-Ardekani B, Wiman KG, Hantz O, Caron de Fromentel C, Chemin IA, Hainaut PL.
Journal:Carcinogenesis. 2010 Aug;31(8):1475-82. Epub 2010 Jun 10.
Entrez:20538734

siRNA sequence "ucacucaccaaccuccugu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ucacucaccaaccuccugu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1116 " record
Length: 19
GC Content:53 %
Starting position: 333
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "ucacucaccaaccuccugu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:19026173
Article:Optimal design and validation of antiviral siRNA for targeting hepatitis B virus.
Authors:Fu J, Tang ZM, Gao X, Zhao F, Zhong H, Wen MR, Sun X, Song HF, Qian XH.
Journal:Acta Pharmacol Sin. 2008 Dec;29(12):1522-8.
Entrez:19026173

siRNA sequence "aagaggacucuuggacucuc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aagaggacucuuggacucuc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1125 " record
Length: 20
GC Content:50 %
Starting position: 1658
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "aagaggacucuuggacucuc" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:19026173
Article:Optimal design and validation of antiviral siRNA for targeting hepatitis B virus.
Authors:Fu J, Tang ZM, Gao X, Zhao F, Zhong H, Wen MR, Sun X, Song HF, Qian XH.
Journal:Acta Pharmacol Sin. 2008 Dec;29(12):1522-8.
Entrez:19026173

siRNA sequence "ccucugcacgucgcaugga" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ccucugcacgucgcaugga" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1050 " record
Length: 19
GC Content:63 %
Starting position: 224
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "ccucugcacgucgcaugga" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18201553
Article:An accurate quantitative method for screening effective siRNA probes targeting a Hepatitis B virus transcript in single living cells.
Authors:Tong WP, Zhou Y, Wang X, Yang F, Wu KL, Wu J, Zhang Y.
Journal:Biochem Biophys Res Commun. 2008 Mar 21;367(4):866-73. Epub 2008 Jan 15.
Entrez:18201553

siRNA sequence "gcacuucgcuucaccucugcacgu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gcacuucgcuucaccucugcacgu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1479 " record
Length: 24
GC Content:58 %
Starting position: 1583
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):96

Offtargets for "gcacuucgcuucaccucugcacgu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:15850463
Article:Inhibition of hepatitis B virus replication in 2.2.15 cells by expressed shRNA.
Authors:Ren XR, Zhou LJ, Luo GB, Lin B, Xu A.
Journal:J Viral Hepat. 2005 May;12(3):236-42.
Entrez:15850463

siRNA sequence "auccagauugggacuucaa" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "auccagauugggacuucaa" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1961 " record
Length: 19
GC Content:42 %
Starting position: 2935
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "auccagauugggacuucaa" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:20642484
Article:Knockdown of HBV surface antigen gene expression by a lentiviral microRNA-based system inhibits HBV replication and HCC growth.
Authors:Xiangji L, Feng X, Qingbao C, Weifeng T, Xiaoqing J, Baihe Z, Feng S, Hongyang W, Mengchao W.
Journal:J Viral Hepat. 2011 Sep;18(9):653-60. doi: 10.1111/j.1365-2893.2010.01346.x. Epub 2010 Jul 19.
Entrez:20642484

siRNA sequence "gacucucagcaaugucaac" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gacucucagcaaugucaac" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1962 " record
Length: 19
GC Content:47 %
Starting position: 1669
GenBank Acc: GU563560
Transfection Reagent: Lipofectamine 2000

Offtargets for "gacucucagcaaugucaac" siRNA in Human Genome sequences
See GU563560 at Genbank
Pubmed:21107751
Article:Dysregulation of β-catenin by hepatitis B virus X protein in HBV-infected human hepatocellular carcinomas.
Authors:Chen L, Hu L, Li L, Liu Y, Tu QQ, Chang YX, Yan HX, Wu MC, Wang HY.
Journal:Front Med China. 2010 Dec;4(4):399-411. Epub 2010 Nov 23.
Entrez:21107751

siRNA sequence "gauccauacugcggaacuccu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gauccauacugcggaacuccu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1475 " record
Length: 21
GC Content:52 %
Starting position: 1625
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):96

Offtargets for "gauccauacugcggaacuccu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:15850463
Article:Inhibition of hepatitis B virus replication in 2.2.15 cells by expressed shRNA.
Authors:Ren XR, Zhou LJ, Luo GB, Lin B, Xu A.
Journal:J Viral Hepat. 2005 May;12(3):236-42.
Entrez:15850463

siRNA sequence "ccuccuguccuccaacuug" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ccuccuguccuccaacuug" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1075 " record
Length: 19
GC Content:58 %
Starting position: 344
Transfection Reagent: Polymer Polyethylenimine (PEI)
Incubation Time (Hours):48

Offtargets for "ccuccuguccuccaacuug" siRNA in Human Genome sequences
See at Genbank
Pubmed:15756649
Article:Stable inhibition of hepatitis B virus proteins by small interfering RNA expressed from viral vectors.
Authors:Moore MD, McGarvey MJ, Russell RA, Cullen BR, McClure MO.
Journal:J Gene Med. 2005 Jul;7(7):918-25.
Entrez:15756649

siRNA sequence "aaagaauuuggagcuacugug" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aaagaauuuggagcuacugug" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1129 " record
Length: 21
GC Content:38 %
Starting position: 1921
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "aaagaauuuggagcuacugug" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:19026173
Article:Optimal design and validation of antiviral siRNA for targeting hepatitis B virus.
Authors:Fu J, Tang ZM, Gao X, Zhao F, Zhong H, Wen MR, Sun X, Song HF, Qian XH.
Journal:Acta Pharmacol Sin. 2008 Dec;29(12):1522-8.
Entrez:19026173

siRNA sequence "uaucaacacuuccggaaacua" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "uaucaacacuuccggaaacua" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1130 " record
Length: 21
GC Content:38 %
Starting position: 2321
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "uaucaacacuuccggaaacua" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:19026173
Article:Optimal design and validation of antiviral siRNA for targeting hepatitis B virus.
Authors:Fu J, Tang ZM, Gao X, Zhao F, Zhong H, Wen MR, Sun X, Song HF, Qian XH.
Journal:Acta Pharmacol Sin. 2008 Dec;29(12):1522-8.
Entrez:19026173


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1021	aaccuccaaucacucaccaac	Hepatitis B Virus [HBV]	S	HepG2.2.15	mRNA	59	18274934	Blast SL	refseqs
virsi1126	gaccuugaggcauacuuca	Hepatitis B Virus [HBV]	X	HepG2.2.15	Protein	58	19026173	Blast SL	refseqs
virsi1088	ccucuuguccuccaauuug	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	57	15754419	Blast SL	refseqs
virsi1449	cagguccccuagaagaagaac	Hepatitis B Virus [HBV]	NLS	HepG2.2.15	Protein	55	18609708	Blast SL	refseqs
virsi1128	uucaccucugccuaaucau	Hepatitis B Virus [HBV]	C	HepG2.2.15	Protein	55	19026173	Blast SL	refseqs
virsi1451	cccuaucuuaucaacacuuccggaa	Hepatitis B Virus [HBV]	C	HepG2.2.15	Protein	55	17588164	Blast SL	refseqs
virsi1455	ggacauugacccguauaaagac	Hepatitis B Virus [HBV]	ORF	HepG2.2.15	Protein	55	18474581	Blast SL	refseqs
virsi1156	gguauguugcccguuuguc	Hepatitis B Virus [HBV]	S	HepG2.2.15	mRNA	55	15316660	Blast SL	refseqs
virsi1022	gccucaucuucuuguuggu	Hepatitis B Virus [HBV]	S	HepG2.2.15	mRNA	54	18274934	Blast SL	refseqs
virsi1450	gggaccaugcagaaccugcacgauu	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	54	17588164	Blast SL	refseqs
virsi1091	guguuugcugacgcaaccc	Hepatitis B Virus [HBV]	P	HepG2.2.15	Protein	54	15754419	Blast SL	refseqs
virsi1118	auguugcccguuuguccucua	Hepatitis B Virus [HBV]	P/S	HepG2.2.15	Protein	54	19026173	Blast SL	refseqs
virsi1452	ggcuggcauucuauauaagagagaa	Hepatitis B Virus [HBV]	P	HepG2.2.15	Protein	54	17588164	Blast SL	refseqs
virsi1457	ucauguccuacuguucaagu	Hepatitis B Virus [HBV]	C	HepG2	Protein	54	16929350	Blast SL	refseqs
virsi1964	acauaagaggacucuugga	Hepatitis B Virus [HBV]	X	PLC/PRF/5	mRNA	52	20538734	Blast SL	refseqs
virsi1116	ucacucaccaaccuccugu	Hepatitis B Virus [HBV]	P/S	HepG2.2.15	Protein	52	19026173	Blast SL	refseqs
virsi1125	aagaggacucuuggacucuc	Hepatitis B Virus [HBV]	X	HepG2.2.15	Protein	51	19026173	Blast SL	refseqs
virsi1050	ccucugcacgucgcaugga	Hepatitis B Virus [HBV]	X	LinX	Protein	51	18201553	Blast SL	refseqs
virsi1479	gcacuucgcuucaccucugcacgu	Hepatitis B Virus [HBV]	P/X	HepG2.2.15	Protein	51	15850463	Blast SL	refseqs
virsi1961	auccagauugggacuucaa	Hepatitis B Virus [HBV]	S	293T	Protein	50	20642484	Blast SL	refseqs
virsi1962	gacucucagcaaugucaac	Hepatitis B Virus [HBV]	X	HepG2	Protein	50	21107751	Blast SL	refseqs
virsi1475	gauccauacugcggaacuccu	Hepatitis B Virus [HBV]	P	HepG2.2.15	Protein	50	15850463	Blast SL	refseqs
virsi1075	ccuccuguccuccaacuug	Hepatitis B Virus [HBV]	S	293T	Protein	49	15756649	Blast SL	refseqs
virsi1129	aaagaauuuggagcuacugug	Hepatitis B Virus [HBV]	C	HepG2.2.15	Protein	48	19026173	Blast SL	refseqs
virsi1130	uaucaacacuuccggaaacua	Hepatitis B Virus [HBV]	C/P	HepG2.2.15	Protein	48	19026173	Blast SL	refseqs



« previous12345678910next »

: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm