VIRsiRNAdb

Browse BY

Family of Virus

Virus Name

Gene Name

Pubmed Id

VsiRNAid

Total number of Results for

Hepadnaviridae

227

Results from

175 - 200

« previous 1 2 3 4 5 6 789 10 next »

siRNA sequence "auugcaccuguauucccau" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "auugcaccuguauucccau" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1045 " record
Length: 19
GC Content:42 %
Starting position: 593
Strain of Virus: adw2
GenBank Acc: AY707087
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "auugcaccuguauucccau" siRNA in Human Genome sequences

See AY707087 at Genbank

Pubmed:17054586
Article:RNA interference inhibits hepatitis B virus gene expression and replication in HepG2-N10 cells.
Authors:Ren JL, Pan JS, Cheng T, Dong J, Lu YP, Huang SJ, Shi HX, Wang L, Lian YM.
Journal:Chin J Dig Dis. 2006;7(4):230-6.
Entrez:17054586

siRNA sequence "aagauccagcaucuagagacc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "aagauccagcaucuagagacc" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1140 " record
Length: 21
GC Content:48 %
Starting position: 2235
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48

Offtargets for "aagauccagcaucuagagacc" siRNA in Human Genome sequences

See U95551 at Genbank

Pubmed:17334648
Article:Effective inhibition of hepatitis B virus replication by small interfering RNAs expressed from human foamy virus vectors.
Authors:Sun Y, Li Z, Li L, Li J, Liu X, Li W.
Journal:Int J Mol Med. 2007 Apr;19(4):705-11.
Entrez:17334648

siRNA sequence "agcucaaacuuucgaaaucaa" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "agcucaaacuuucgaaaucaa" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1667 " record
Length: 21
GC Content:33 %
Starting position: 3279
GenBank Acc: M19183
Transfection Reagent: Lipofectamine 2000

Offtargets for "agcucaaacuuucgaaaucaa" siRNA in Human Genome sequences

See M19183 at Genbank

Pubmed:19064272
Article:Inhibition of woodchuck hepatitis virus gene expression in primary hepatocytes by siRNA enhances the cellular gene expression.
Authors:Meng Z, Qiu S, Zhang X, Wu J, Schreiter T, Xu Y, Yang D, Roggendorf M, Schlaak J, Lu M.
Journal:Virology. 2009 Feb 5;384(1):88-96. Epub 2008 Dec 6.
Entrez:19064272

siRNA sequence "cagguccccuagaagaagaac" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "cagguccccuagaagaagaac" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1017 " record
Length: 21
GC Content:52 %
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):96

Offtargets for "cagguccccuagaagaagaac" siRNA in Human Genome sequences

See at Genbank

Pubmed:17300745
Article:Inhibition of Hepatitis B virus cccDNA replication by siRNA.
Authors:Li GQ, Gu HX, Li D, Xu WZ.
Journal:Biochem Biophys Res Commun. 2007 Apr 6;355(2):404-8. Epub 2007 Feb 6.
Entrez:17300745

siRNA sequence "ucuucucgaggacugggga" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "ucuucucgaggacugggga" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1087 " record
Length: 19
GC Content:58 %
Starting position: 123
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72

Offtargets for "ucuucucgaggacugggga" siRNA in Human Genome sequences

See U95551 at Genbank

Pubmed:15754419
Article:Combination of small interfering RNAs mediates greater inhibition of human hepatitis B virus replication and antigen expression.
Authors:Chen Z, Xu ZF, Ye JJ, Yao HP, Zheng S, Ding JY.
Journal:J Zhejiang Univ Sci B. 2005 Apr;6(4):236-41.
Entrez:15754419

siRNA sequence "gcugugccuuggguggcuu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "gcugugccuuggguggcuu" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1093 " record
Length: 19
GC Content:63 %
Starting position: 1820
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72

Offtargets for "gcugugccuuggguggcuu" siRNA in Human Genome sequences

See U95551 at Genbank

siRNA sequence "gguauguugcccguuuguc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "gguauguugcccguuuguc" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1089 " record
Length: 19
GC Content:53 %
Starting position: 458
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72

Offtargets for "gguauguugcccguuuguc" siRNA in Human Genome sequences

See U95551 at Genbank

siRNA sequence "uaccgcagagucuagacuc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "uaccgcagagucuagacuc" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1096 " record
Length: 19
GC Content:53 %
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Oligofectamine
Incubation Time (Hours):168

Offtargets for "uaccgcagagucuagacuc" siRNA in Human Genome sequences

See U95551 at Genbank

Pubmed:14512871
Article:Inhibition of HBV replication by siRNA in a stable HBV-producing cell line.
Authors:Konishi M, Wu CH, Wu GY.
Journal:Hepatology. 2003 Oct;38(4):842-50.
Entrez:14512871

siRNA sequence "uauacaucguuuccauggc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "uauacaucguuuccauggc" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1078 " record
Length: 19
GC Content:42 %
Starting position: 1362
Transfection Reagent: Polymer Polyethylenimine (PEI)
Incubation Time (Hours):48

Offtargets for "uauacaucguuuccauggc" siRNA in Human Genome sequences

See at Genbank

Pubmed:15756649
Article:Stable inhibition of hepatitis B virus proteins by small interfering RNA expressed from viral vectors.
Authors:Moore MD, McGarvey MJ, Russell RA, Cullen BR, McClure MO.
Journal:J Gene Med. 2005 Jul;7(7):918-25.
Entrez:15756649

siRNA sequence "caggauccucaaccacccac" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "caggauccucaaccacccac" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1665 " record
Length: 20
GC Content:60 %
Starting position: 488
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48

Offtargets for "caggauccucaaccacccac" siRNA in Human Genome sequences

See U95551 at Genbank

Pubmed:15387899
Article:[Establish a screening system for selection of mRNA target sites for HBsAg to construct siRNA with shRNA].
Authors:Yang ZG, Chen Z, Xu N, Ni Q, Pan XC, Jin HY, Li MW.
Journal:Zhonghua Gan Zang Bing Za Zhi. 2004 Sep;12(9):515-8. Chinese.
Entrez:15387899

siRNA sequence "ugucaacguccgaccuuga" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "ugucaacguccgaccuuga" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1438 " record
Length: 19
GC Content:53 %
Starting position: 1678
Incubation Time (Hours):72

Offtargets for "ugucaacguccgaccuuga" siRNA in Human Genome sequences

See at Genbank

Pubmed:16443303
Article:Efficient inhibition of hepatitis B virus replication by small interfering RNAs targeted to the viral X gene in mice.
Authors:Shin D, Kim SI, Kim M, Park M.
Journal:Virus Res. 2006 Aug;119(2):146-53. Epub 2006 Jan 26.
Entrez:16443303

siRNA sequence "aacacuuccggaaacuacugu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "aacacuuccggaaacuacugu" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1018 " record
Length: 21
GC Content:43 %
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):96

Offtargets for "aacacuuccggaaacuacugu" siRNA in Human Genome sequences

See at Genbank

siRNA sequence "gccaaaauucgcaguccc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "gccaaaauucgcaguccc" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1309 " record
Length: 18
GC Content:56 %
Starting position: 305
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Sofast
Incubation Time (Hours):48

Offtargets for "gccaaaauucgcaguccc" siRNA in Human Genome sequences

See U95551 at Genbank

Pubmed:16022904
Article:Inhibition of Hepatitis B virus gene expression by single and dual small interfering RNA treatment.
Authors:Wu KL, Zhang X, Zhang J, Yang Y, Mu YX, Liu M, Lu L, Li Y, Zhu Y, Wu J.
Journal:Virus Res. 2005 Sep;112(1-2):100-7. Epub 2005 Apr 26.
Entrez:16022904

siRNA sequence "gccuuagagucuccugagcu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "gccuuagagucuccugagcu" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1456 " record
Length: 20
GC Content:55 %
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "gccuuagagucuccugagcu" siRNA in Human Genome sequences

See at Genbank

Pubmed:16929350
Article:Long-term inhibition of hepatitis B virus in transgenic mice by double-stranded adeno-associated virus 8-delivered short hairpin RNA.
Authors:Chen CC, Ko TM, Ma HI, Wu HL, Xiao X, Li J, Chang CM, Wu PY, Chen CH, Han JM, Yu CP, Jeng KS, Hu CP, Tao MH.
Journal:Gene Ther. 2007 Jan;14(1):11-9. Epub 2006 Aug 24.
Entrez:16929350

siRNA sequence "uaugguuuugggggccaaguc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "uaugguuuugggggccaaguc" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1121 " record
Length: 21
GC Content:52 %
Starting position: 748
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "uaugguuuugggggccaaguc" siRNA in Human Genome sequences

See U95551 at Genbank

Pubmed:19026173
Article:Optimal design and validation of antiviral siRNA for targeting hepatitis B virus.
Authors:Fu J, Tang ZM, Gao X, Zhao F, Zhong H, Wen MR, Sun X, Song HF, Qian XH.
Journal:Acta Pharmacol Sin. 2008 Dec;29(12):1522-8.
Entrez:19026173

siRNA sequence "aagaucucaaucucgggaauc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "aagaucucaaucucgggaauc" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1134 " record
Length: 21
GC Content:43 %
Starting position: 2422
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "aagaucucaaucucgggaauc" siRNA in Human Genome sequences

See U95551 at Genbank

siRNA sequence "cuuuuucaccucugccuaa" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "cuuuuucaccucugccuaa" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1092 " record
Length: 19
GC Content:42 %
Starting position: 1820
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72

Offtargets for "cuuuuucaccucugccuaa" siRNA in Human Genome sequences

See U95551 at Genbank

siRNA sequence "agaauuuggagcuacugug" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "agaauuuggagcuacugug" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1046 " record
Length: 19
GC Content:42 %
Starting position: 1923
Strain of Virus: adw2
GenBank Acc: AY707087
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "agaauuuggagcuacugug" siRNA in Human Genome sequences

See AY707087 at Genbank

siRNA sequence "gcgucgcagaagaucucaa" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "gcgucgcagaagaucucaa" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1133 " record
Length: 19
GC Content:53 %
Starting position: 2414
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gcgucgcagaagaucucaa" siRNA in Human Genome sequences

See U95551 at Genbank

siRNA sequence "gaucucaaucucgggaaccucaa" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "gaucucaaucucgggaaccucaa" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1019 " record
Length: 23
GC Content:48 %
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):96

Offtargets for "gaucucaaucucgggaaccucaa" siRNA in Human Genome sequences

See at Genbank

siRNA sequence "ggucuuacauaagaggacu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "ggucuuacauaagaggacu" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1044 " record
Length: 19
GC Content:42 %
Starting position: 1648
Strain of Virus: adw2
GenBank Acc: AY707087
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "ggucuuacauaagaggacu" siRNA in Human Genome sequences

See AY707087 at Genbank

siRNA sequence "aaacuacuguuguuagacga" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "aaacuacuguuguuagacga" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1132 " record
Length: 20
GC Content:35 %
Starting position: 2336
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "aaacuacuguuguuagacga" siRNA in Human Genome sequences

See U95551 at Genbank

siRNA sequence "uccucacaauaccgcagag" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "uccucacaauaccgcagag" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1071 " record
Length: 19
GC Content:53 %
Starting position: 230
Transfection Reagent: Polymer Polyethylenimine (PEI)
Incubation Time (Hours):48

Offtargets for "uccucacaauaccgcagag" siRNA in Human Genome sequences

See at Genbank

siRNA sequence "gccuaugggagugggccucag" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "gccuaugggagugggccucag" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1082 " record
Length: 21
GC Content:67 %
Transfection Reagent: Effectene
Incubation Time (Hours):120

Offtargets for "gccuaugggagugggccucag" siRNA in Human Genome sequences

See at Genbank

Pubmed:16254373
Article:Genomic analysis of anti-hepatitis B virus (HBV) activity by small interfering RNA and lamivudine in stable HBV-producing cells.
Authors:Guo Y, Guo H, Zhang L, Xie H, Zhao X, Wang F, Li Z, Wang Y, Ma S, Tao J, Wang W, Zhou Y, Yang W, Cheng J.
Journal:J Virol. 2005 Nov;79(22):14392-403.
Entrez:16254373

siRNA sequence "ggaagaagaacucccucgccu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "ggaagaagaacucccucgccu" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1084 " record
Length: 21
GC Content:57 %
Transfection Reagent: Effectene
Incubation Time (Hours):120

Offtargets for "ggaagaagaacucccucgccu" siRNA in Human Genome sequences

See at Genbank

VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With
virsi1045	auugcaccuguauucccau	Hepatitis B Virus [HBV]	S	HepG2-N10	Protein	46	17054586	Blast SL	refseqs
virsi1140	aagauccagcaucuagagacc	Hepatitis B Virus [HBV]	C	HepG2	RNA	46	17334648	Blast SL	refseqs
virsi1667	agcucaaacuuucgaaaucaa	Hepatitis B Virus [HBV]	Pres1	BHK/HepG2	RNA	45	19064272	Blast SL	refseqs
virsi1017	cagguccccuagaagaagaac	Hepatitis B Virus [HBV]	P	HepG2.2.15	RNA	45	17300745	Blast SL	refseqs
virsi1087	ucuucucgaggacugggga	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	44	15754419	Blast SL	refseqs
virsi1093	gcugugccuuggguggcuu	Hepatitis B Virus [HBV]	C	HepG2.2.15	Protein	44	15754419	Blast SL	refseqs
virsi1089	gguauguugcccguuuguc	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	43	15754419	Blast SL	refseqs
virsi1096	uaccgcagagucuagacuc	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	42	14512871	Blast SL	refseqs
virsi1078	uauacaucguuuccauggc	Hepatitis B Virus [HBV]	S	293T	Protein	42	15756649	Blast SL	refseqs
virsi1665	caggauccucaaccacccac	Hepatitis B Virus [HBV]	S	HeLa	Protein	41	15387899	Blast SL	refseqs
virsi1438	ugucaacguccgaccuuga	Hepatitis B Virus [HBV]	X	Huh-7	Protein	40	16443303	Blast SL	refseqs
virsi1018	aacacuuccggaaacuacugu	Hepatitis B Virus [HBV]	P	HepG2.2.15	RNA	40	17300745	Blast SL	refseqs
virsi1309	gccaaaauucgcaguccc	Hepatitis B Virus [HBV]	S	BEL-7402	Protein	37	16022904	Blast SL	refseqs
virsi1456	gccuuagagucuccugagcu	Hepatitis B Virus [HBV]	C	HepG2	Protein	36	16929350	Blast SL	refseqs
virsi1121	uaugguuuugggggccaaguc	Hepatitis B Virus [HBV]	P/S	HepG2.2.15	Protein	35	19026173	Blast SL	refseqs
virsi1134	aagaucucaaucucgggaauc	Hepatitis B Virus [HBV]	C/P	HepG2.2.15	Protein	33	19026173	Blast SL	refseqs
virsi1092	cuuuuucaccucugccuaa	Hepatitis B Virus [HBV]	C	HepG2.2.15	Protein	33	15754419	Blast SL	refseqs
virsi1046	agaauuuggagcuacugug	Hepatitis B Virus [HBV]	C	HepG2-N10	Protein	30	17054586	Blast SL	refseqs
virsi1133	gcgucgcagaagaucucaa	Hepatitis B Virus [HBV]	C/P	HepG2.2.15	Protein	30	19026173	Blast SL	refseqs
virsi1019	gaucucaaucucgggaaccucaa	Hepatitis B Virus [HBV]	P	HepG2.2.15	RNA	30	17300745	Blast SL	refseqs
virsi1044	ggucuuacauaagaggacu	Hepatitis B Virus [HBV]	X	HepG2-N10	Protein	27	17054586	Blast SL	refseqs
virsi1132	aaacuacuguuguuagacga	Hepatitis B Virus [HBV]	C/P	HepG2.2.15	Protein	27	19026173	Blast SL	refseqs
virsi1071	uccucacaauaccgcagag	Hepatitis B Virus [HBV]	S	293T	Protein	23	15756649	Blast SL	refseqs
virsi1082	gccuaugggagugggccucag	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	22	16254373	Blast SL	refseqs
virsi1084	ggaagaagaacucccucgccu	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	22	16254373	Blast SL	refseqs

« previous 1 2 3 4 5 6 789 10 next »

: siRNA seedlocator algorithm

VIRsiRNAdb

Database of Viral siRNA / shRNA

Browse BY