VIRsiRNAdb

siRNA sequence "ucacucaccaaccuccugu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "ucacucaccaaccuccugu" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1074 " record
Length: 19
GC Content:53 %
Starting position: 333
Transfection Reagent: Polymer Polyethylenimine (PEI)
Incubation Time (Hours):48

Offtargets for "ucacucaccaaccuccugu" siRNA in Human Genome sequences

See at Genbank

Pubmed:15756649
Article:Stable inhibition of hepatitis B virus proteins by small interfering RNA expressed from viral vectors.
Authors:Moore MD, McGarvey MJ, Russell RA, Cullen BR, McClure MO.
Journal:J Gene Med. 2005 Jul;7(7):918-25.
Entrez:15756649

siRNA sequence "gcucaguuuacuagugcca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "gcucaguuuacuagugcca" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi2013 " record
Length: 19
GC Content:47 %
Starting position: 672
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Sofast
Incubation Time (Hours):48

Offtargets for "gcucaguuuacuagugcca" siRNA in Human Genome sequences

See U95551 at Genbank

Pubmed:16022904
Article:Inhibition of Hepatitis B virus gene expression by single and dual small interfering RNA treatment.
Authors:Wu KL, Zhang X, Zhang J, Yang Y, Mu YX, Liu M, Lu L, Li Y, Zhu Y, Wu J.
Journal:Virus Res. 2005 Sep;112(1-2):100-7. Epub 2005 Apr 26.
Entrez:16022904

siRNA sequence "aagagaaaccguuauagagua" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "aagagaaaccguuauagagua" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1142 " record
Length: 21
GC Content:33 %
Starting position: 2235
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48

Offtargets for "aagagaaaccguuauagagua" siRNA in Human Genome sequences

See U95551 at Genbank

Pubmed:17334648
Article:Effective inhibition of hepatitis B virus replication by small interfering RNAs expressed from human foamy virus vectors.
Authors:Sun Y, Li Z, Li L, Li J, Liu X, Li W.
Journal:Int J Mol Med. 2007 Apr;19(4):705-11.
Entrez:17334648

siRNA sequence "uaccuaugggagugggccu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "uaccuaugggagugggccu" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1058 " record
Length: 19
GC Content:58 %
Starting position: 637
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):60

Offtargets for "uaccuaugggagugggccu" siRNA in Human Genome sequences

See at Genbank

Pubmed:16153600
Article:Therapeutic inhibition of hepatitis B virus surface antigen expression by RNA interference.
Authors:Cheng TL, Chang WW, Su IJ, Lai MD, Huang W, Lei HY, Chang WT.
Journal:Biochem Biophys Res Commun. 2005 Oct 28;336(3):820-30.
Entrez:16153600

siRNA sequence "guccucuaauuccaggauc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "guccucuaauuccaggauc" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1066 " record
Length: 19
GC Content:47 %
Starting position: 476
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):60

Offtargets for "guccucuaauuccaggauc" siRNA in Human Genome sequences

See at Genbank

Pubmed:16153600
Article:Therapeutic inhibition of hepatitis B virus surface antigen expression by RNA interference.
Authors:Cheng TL, Chang WW, Su IJ, Lai MD, Huang W, Lei HY, Chang WT.
Journal:Biochem Biophys Res Commun. 2005 Oct 28;336(3):820-30.
Entrez:16153600

siRNA sequence "ggacucgugguggacuucucu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "ggacucgugguggacuucucu" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1085 " record
Length: 21
GC Content:57 %
Transfection Reagent: Effectene
Incubation Time (Hours):120

Offtargets for "ggacucgugguggacuucucu" siRNA in Human Genome sequences

See at Genbank

Pubmed:16254373
Article:Genomic analysis of anti-hepatitis B virus (HBV) activity by small interfering RNA and lamivudine in stable HBV-producing cells.
Authors:Guo Y, Guo H, Zhang L, Xie H, Zhao X, Wang F, Li Z, Wang Y, Ma S, Tao J, Wang W, Zhou Y, Yang W, Cheng J.
Journal:J Virol. 2005 Nov;79(22):14392-403.
Entrez:16254373

siRNA sequence "ggaagccuccaagcugugccu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "ggaagccuccaagcugugccu" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1083 " record
Length: 21
GC Content:62 %
Transfection Reagent: Effectene
Incubation Time (Hours):120

Offtargets for "ggaagccuccaagcugugccu" siRNA in Human Genome sequences

See at Genbank

Pubmed:16254373
Article:Genomic analysis of anti-hepatitis B virus (HBV) activity by small interfering RNA and lamivudine in stable HBV-producing cells.
Authors:Guo Y, Guo H, Zhang L, Xie H, Zhao X, Wang F, Li Z, Wang Y, Ma S, Tao J, Wang W, Zhou Y, Yang W, Cheng J.
Journal:J Virol. 2005 Nov;79(22):14392-403.
Entrez:16254373

siRNA sequence "auguaucccuccuguugcu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "auguaucccuccuguugcu" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1664 " record
Length: 19
GC Content:47 %
Starting position: 554
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "auguaucccuccuguugcu" siRNA in Human Genome sequences

See U95551 at Genbank

Pubmed:15387899
Article:[Establish a screening system for selection of mRNA target sites for HBsAg to construct siRNA with shRNA].
Authors:Yang ZG, Chen Z, Xu N, Ni Q, Pan XC, Jin HY, Li MW.
Journal:Zhonghua Gan Zang Bing Za Zhi. 2004 Sep;12(9):515-8. Chinese.
Entrez:15387899

siRNA sequence "gcucaguuuacuagugcca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "gcucaguuuacuagugcca" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1311 " record
Length: 19
GC Content:47 %
Starting position: 672
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Sofast
Incubation Time (Hours):48

Offtargets for "gcucaguuuacuagugcca" siRNA in Human Genome sequences

See U95551 at Genbank

Pubmed:16022904
Article:Inhibition of Hepatitis B virus gene expression by single and dual small interfering RNA treatment.
Authors:Wu KL, Zhang X, Zhang J, Yang Y, Mu YX, Liu M, Lu L, Li Y, Zhu Y, Wu J.
Journal:Virus Res. 2005 Sep;112(1-2):100-7. Epub 2005 Apr 26.
Entrez:16022904

siRNA sequence "ggccaaguguuugcugacgca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "ggccaaguguuugcugacgca" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1086 " record
Length: 21
GC Content:57 %
Transfection Reagent: Effectene
Incubation Time (Hours):120

Offtargets for "ggccaaguguuugcugacgca" siRNA in Human Genome sequences

See at Genbank

Pubmed:16254373
Article:Genomic analysis of anti-hepatitis B virus (HBV) activity by small interfering RNA and lamivudine in stable HBV-producing cells.
Authors:Guo Y, Guo H, Zhang L, Xie H, Zhao X, Wang F, Li Z, Wang Y, Ma S, Tao J, Wang W, Zhou Y, Yang W, Cheng J.
Journal:J Virol. 2005 Nov;79(22):14392-403.
Entrez:16254373

siRNA sequence "gcacuucgcuucaccucug" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "gcacuucgcuucaccucug" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1312 " record
Length: 19
GC Content:58 %
Starting position: 1583
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Sofast
Incubation Time (Hours):48

Offtargets for "gcacuucgcuucaccucug" siRNA in Human Genome sequences

See U95551 at Genbank

Pubmed:16022904
Article:Inhibition of Hepatitis B virus gene expression by single and dual small interfering RNA treatment.
Authors:Wu KL, Zhang X, Zhang J, Yang Y, Mu YX, Liu M, Lu L, Li Y, Zhu Y, Wu J.
Journal:Virus Res. 2005 Sep;112(1-2):100-7. Epub 2005 Apr 26.
Entrez:16022904

siRNA sequence "ggcagccuacucccaucuc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "ggcagccuacucccaucuc" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1063 " record
Length: 19
GC Content:63 %
Starting position: 3162
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):60

Offtargets for "ggcagccuacucccaucuc" siRNA in Human Genome sequences

See at Genbank

Pubmed:16153600
Article:Therapeutic inhibition of hepatitis B virus surface antigen expression by RNA interference.
Authors:Cheng TL, Chang WW, Su IJ, Lai MD, Huang W, Lei HY, Chang WT.
Journal:Biochem Biophys Res Commun. 2005 Oct 28;336(3):820-30.
Entrez:16153600

siRNA sequence "ucuccgcgaggacugggga" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "ucuccgcgaggacugggga" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1065 " record
Length: 19
GC Content:68 %
Starting position: 125
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):60

Offtargets for "ucuccgcgaggacugggga" siRNA in Human Genome sequences

See at Genbank

Pubmed:16153600
Article:Therapeutic inhibition of hepatitis B virus surface antigen expression by RNA interference.
Authors:Cheng TL, Chang WW, Su IJ, Lai MD, Huang W, Lei HY, Chang WT.
Journal:Biochem Biophys Res Commun. 2005 Oct 28;336(3):820-30.
Entrez:16153600

siRNA sequence "acacuuccgaaacuacuguu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "acacuuccgaaacuacuguu" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1131 " record
Length: 20
GC Content:40 %
Starting position: 2326
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "acacuuccgaaacuacuguu" siRNA in Human Genome sequences

See U95551 at Genbank

Pubmed:19026173
Article:Optimal design and validation of antiviral siRNA for targeting hepatitis B virus.
Authors:Fu J, Tang ZM, Gao X, Zhao F, Zhong H, Wen MR, Sun X, Song HF, Qian XH.
Journal:Acta Pharmacol Sin. 2008 Dec;29(12):1522-8.
Entrez:19026173

siRNA sequence "ccugcacgacuccugcuca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "ccugcacgacuccugcuca" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1057 " record
Length: 19
GC Content:63 %
Starting position: 524
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):60

Offtargets for "ccugcacgacuccugcuca" siRNA in Human Genome sequences

See at Genbank

Pubmed:16153600
Article:Therapeutic inhibition of hepatitis B virus surface antigen expression by RNA interference.
Authors:Cheng TL, Chang WW, Su IJ, Lai MD, Huang W, Lei HY, Chang WT.
Journal:Biochem Biophys Res Commun. 2005 Oct 28;336(3):820-30.
Entrez:16153600

siRNA sequence "caucacaucaggauuccua" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "caucacaucaggauuccua" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1069 " record
Length: 19
GC Content:42 %
Starting position: 165
Transfection Reagent: Polymer Polyethylenimine (PEI)
Incubation Time (Hours):48

Offtargets for "caucacaucaggauuccua" siRNA in Human Genome sequences

See at Genbank

Pubmed:15756649
Article:Stable inhibition of hepatitis B virus proteins by small interfering RNA expressed from viral vectors.
Authors:Moore MD, McGarvey MJ, Russell RA, Cullen BR, McClure MO.
Journal:J Gene Med. 2005 Jul;7(7):918-25.
Entrez:15756649

siRNA sequence "uaccgcagagucuagacuc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "uaccgcagagucuagacuc" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1072 " record
Length: 19
GC Content:53 %
Starting position: 239
Transfection Reagent: Polymer Polyethylenimine (PEI)
Incubation Time (Hours):48

Offtargets for "uaccgcagagucuagacuc" siRNA in Human Genome sequences

See at Genbank

Pubmed:15756649
Article:Stable inhibition of hepatitis B virus proteins by small interfering RNA expressed from viral vectors.
Authors:Moore MD, McGarvey MJ, Russell RA, Cullen BR, McClure MO.
Journal:J Gene Med. 2005 Jul;7(7):918-25.
Entrez:15756649

siRNA sequence "gaucucaaucucgggaaccucaa" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "gaucucaaucucgggaaccucaa" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1135 " record
Length: 23
GC Content:48 %
Starting position: 2358
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gaucucaaucucgggaaccucaa" siRNA in Human Genome sequences

See U95551 at Genbank

Pubmed:19026173
Article:Optimal design and validation of antiviral siRNA for targeting hepatitis B virus.
Authors:Fu J, Tang ZM, Gao X, Zhao F, Zhong H, Wen MR, Sun X, Song HF, Qian XH.
Journal:Acta Pharmacol Sin. 2008 Dec;29(12):1522-8.
Entrez:19026173

siRNA sequence "guugcuguaccaaaccuu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "guugcuguaccaaaccuu" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1310 " record
Length: 18
GC Content:44 %
Starting position: 566
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Sofast
Incubation Time (Hours):48

Offtargets for "guugcuguaccaaaccuu" siRNA in Human Genome sequences

See U95551 at Genbank

Pubmed:16022904
Article:Inhibition of Hepatitis B virus gene expression by single and dual small interfering RNA treatment.
Authors:Wu KL, Zhang X, Zhang J, Yang Y, Mu YX, Liu M, Lu L, Li Y, Zhu Y, Wu J.
Journal:Virus Res. 2005 Sep;112(1-2):100-7. Epub 2005 Apr 26.
Entrez:16022904

siRNA sequence "uuccuaugggagugggccu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "uuccuaugggagugggccu" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1076 " record
Length: 19
GC Content:58 %
Starting position: 637
Transfection Reagent: Polymer Polyethylenimine (PEI)
Incubation Time (Hours):48

Offtargets for "uuccuaugggagugggccu" siRNA in Human Genome sequences

See at Genbank

Pubmed:15756649
Article:Stable inhibition of hepatitis B virus proteins by small interfering RNA expressed from viral vectors.
Authors:Moore MD, McGarvey MJ, Russell RA, Cullen BR, McClure MO.
Journal:J Gene Med. 2005 Jul;7(7):918-25.
Entrez:15756649

siRNA sequence "gagacagucauccucaggc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "gagacagucauccucaggc" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1064 " record
Length: 19
GC Content:58 %
Starting position: 3192
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):60

Offtargets for "gagacagucauccucaggc" siRNA in Human Genome sequences

See at Genbank

Pubmed:16153600
Article:Therapeutic inhibition of hepatitis B virus surface antigen expression by RNA interference.
Authors:Cheng TL, Chang WW, Su IJ, Lai MD, Huang W, Lei HY, Chang WT.
Journal:Biochem Biophys Res Commun. 2005 Oct 28;336(3):820-30.
Entrez:16153600

siRNA sequence "aacugacaauucugucguccu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "aacugacaauucugucguccu" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1958 " record
Length: 21
GC Content:43 %
Starting position: 1329
Strain of Virus: adw
GenBank Acc: AM282986
Transfection Reagent: FuGENE
Incubation Time (Hours):48

Offtargets for "aacugacaauucugucguccu" siRNA in Human Genome sequences

See AM282986 at Genbank

Pubmed:20822550
Article:Identification of an effective siRNA target site and functional regulatory elements, within the hepatitis B virus posttranscriptional regulatory element.
Authors:Panjaworayan N, Payungporn S, Poovorawan Y, Brown CM.
Journal:Virol J. 2010 Sep 8;7:216.
Entrez:20822550

siRNA sequence "guuuaaagacugggaggag" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "guuuaaagacugggaggag" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1314 " record
Length: 19
GC Content:47 %
Starting position: 1723
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Sofast
Incubation Time (Hours):48

Offtargets for "guuuaaagacugggaggag" siRNA in Human Genome sequences

See U95551 at Genbank

Pubmed:16022904
Article:Inhibition of Hepatitis B virus gene expression by single and dual small interfering RNA treatment.
Authors:Wu KL, Zhang X, Zhang J, Yang Y, Mu YX, Liu M, Lu L, Li Y, Zhu Y, Wu J.
Journal:Virus Res. 2005 Sep;112(1-2):100-7. Epub 2005 Apr 26.
Entrez:16022904

siRNA sequence "guugcuguaccaaaccuu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "guugcuguaccaaaccuu" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1998 " record
Length: 18
GC Content:44 %
Starting position: 566
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Sofast
Incubation Time (Hours):48

Offtargets for "guugcuguaccaaaccuu" siRNA in Human Genome sequences

See U95551 at Genbank

Pubmed:16022904
Article:Inhibition of Hepatitis B virus gene expression by single and dual small interfering RNA treatment.
Authors:Wu KL, Zhang X, Zhang J, Yang Y, Mu YX, Liu M, Lu L, Li Y, Zhu Y, Wu J.
Journal:Virus Res. 2005 Sep;112(1-2):100-7. Epub 2005 Apr 26.
Entrez:16022904

siRNA sequence "guuuaaagacugggaggag" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "guuuaaagacugggaggag" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi2015 " record
Length: 19
GC Content:47 %
Starting position: 1723
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Sofast
Incubation Time (Hours):48

Offtargets for "guuuaaagacugggaggag" siRNA in Human Genome sequences

See U95551 at Genbank

Pubmed:16022904
Article:Inhibition of Hepatitis B virus gene expression by single and dual small interfering RNA treatment.
Authors:Wu KL, Zhang X, Zhang J, Yang Y, Mu YX, Liu M, Lu L, Li Y, Zhu Y, Wu J.
Journal:Virus Res. 2005 Sep;112(1-2):100-7. Epub 2005 Apr 26.
Entrez:16022904

VIRsiRNAdb

Database of Viral siRNA / shRNA

Browse BY

VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With
virsi1074	ucacucaccaaccuccugu	Hepatitis B Virus [HBV]	S	293T	Protein	21	15756649	Blast SL	refseqs
virsi2013	gcucaguuuacuagugcca	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	20	16022904	Blast SL	refseqs
virsi1142	aagagaaaccguuauagagua	Hepatitis B Virus [HBV]	C	HepG2	RNA	20	17334648	Blast SL	refseqs
virsi1058	uaccuaugggagugggccu	Hepatitis B Virus [HBV]	S	Huh-7	Protein	20	16153600	Blast SL	refseqs
virsi1066	guccucuaauuccaggauc	Hepatitis B Virus [HBV]	S	Huh-7	Protein	20	16153600	Blast SL	refseqs
virsi1085	ggacucgugguggacuucucu	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	20	16254373	Blast SL	refseqs
virsi1083	ggaagccuccaagcugugccu	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	19	16254373	Blast SL	refseqs
virsi1664	auguaucccuccuguugcu	Hepatitis B Virus [HBV]	S	HeLa	Protein	19	15387899	Blast SL	refseqs
virsi1311	gcucaguuuacuagugcca	Hepatitis B Virus [HBV]	S	BEL-7402	Protein	16	16022904	Blast SL	refseqs
virsi1086	ggccaaguguuugcugacgca	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	15	16254373	Blast SL	refseqs
virsi1312	gcacuucgcuucaccucug	Hepatitis B Virus [HBV]	X	BEL-7402	Protein	13	16022904	Blast SL	refseqs
virsi1063	ggcagccuacucccaucuc	Hepatitis B Virus [HBV]	S	Huh-7	Protein	12	16153600	Blast SL	refseqs
virsi1065	ucuccgcgaggacugggga	Hepatitis B Virus [HBV]	S	Huh-7	Protein	11	16153600	Blast SL	refseqs
virsi1131	acacuuccgaaacuacuguu	Hepatitis B Virus [HBV]	C/P	HepG2.2.15	Protein	10	19026173	Blast SL	refseqs
virsi1057	ccugcacgacuccugcuca	Hepatitis B Virus [HBV]	S	Huh-7	Protein	7	16153600	Blast SL	refseqs
virsi1069	caucacaucaggauuccua	Hepatitis B Virus [HBV]	S	293T	Protein	6	15756649	Blast SL	refseqs
virsi1072	uaccgcagagucuagacuc	Hepatitis B Virus [HBV]	S	293T	Protein	6	15756649	Blast SL	refseqs
virsi1135	gaucucaaucucgggaaccucaa	Hepatitis B Virus [HBV]	C/P	HepG2.2.15	Protein	4	19026173	Blast SL	refseqs
virsi1310	guugcuguaccaaaccuu	Hepatitis B Virus [HBV]	S	BEL-7402	Protein	2	16022904	Blast SL	refseqs
virsi1076	uuccuaugggagugggccu	Hepatitis B Virus [HBV]	S	293T	Protein	1	15756649	Blast SL	refseqs
virsi1064	gagacagucauccucaggc	Hepatitis B Virus [HBV]	S	Huh-7	Protein	1	16153600	Blast SL	refseqs
virsi1958	aacugacaauucugucguccu	Hepatitis B Virus [HBV]	PRE	COS-7	Protein	0	20822550	Blast SL	refseqs
virsi1314	guuuaaagacugggaggag	Hepatitis B Virus [HBV]	X	BEL-7402	Protein	0	16022904	Blast SL	refseqs
virsi1998	guugcuguaccaaaccuu	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	0	16022904	Blast SL	refseqs
virsi2015	guuuaaagacugggaggag	Hepatitis B Virus [HBV]	X	HepG2.2.15	Protein	0	16022904	Blast SL	refseqs