VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for Hepadnaviridae are 227
Results from 0 - 25

« previous12345678910next »
siRNA sequence "auuccuaugggagugggcc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "auuccuaugggagugggcc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1959 " record
Length: 19
GC Content:58 %
Starting position: 636
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "auuccuaugggagugggcc" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:20642484
Article:Knockdown of HBV surface antigen gene expression by a lentiviral microRNA-based system inhibits HBV replication and HCC growth.
Authors:Xiangji L, Feng X, Qingbao C, Weifeng T, Xiaoqing J, Baihe Z, Feng S, Hongyang W, Mengchao W.
Journal:J Viral Hepat. 2011 Sep;18(9):653-60. doi: 10.1111/j.1365-2893.2010.01346.x. Epub 2010 Jul 19.
Entrez:20642484

siRNA sequence "cucaguuuacuagugccauuuguuc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "cucaguuuacuagugccauuuguuc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1446 " record
Length: 25
GC Content:40 %
Incubation Time (Hours):168

Offtargets for "cucaguuuacuagugccauuuguuc" siRNA in Human Genome sequences
See at Genbank
Pubmed:19804649
Article:Hepatitis B virus inhibition in mice by lentiviral vector mediated short hairpin RNA.
Authors:Deng L, Li G, Xi L, Yin A, Gao Y, You W, Wang X, Sun B.
Journal:BMC Gastroenterol. 2009 Oct 6;9:73.
Entrez:19804649

siRNA sequence "gguauguugcccguuuguc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gguauguugcccguuuguc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1067 " record
Length: 19
GC Content:53 %
Starting position: 460
Transfection Reagent: Polymer Polyethylenimine (PEI)
Incubation Time (Hours):48

Offtargets for "gguauguugcccguuuguc" siRNA in Human Genome sequences
See at Genbank
Pubmed:15756649
Article:Stable inhibition of hepatitis B virus proteins by small interfering RNA expressed from viral vectors.
Authors:Moore MD, McGarvey MJ, Russell RA, Cullen BR, McClure MO.
Journal:J Gene Med. 2005 Jul;7(7):918-25.
Entrez:15756649

siRNA sequence "gguauguugcccguuuguc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gguauguugcccguuuguc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1960 " record
Length: 19
GC Content:53 %
Starting position: 460
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gguauguugcccguuuguc" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:20642484
Article:Knockdown of HBV surface antigen gene expression by a lentiviral microRNA-based system inhibits HBV replication and HCC growth.
Authors:Xiangji L, Feng X, Qingbao C, Weifeng T, Xiaoqing J, Baihe Z, Feng S, Hongyang W, Mengchao W.
Journal:J Viral Hepat. 2011 Sep;18(9):653-60. doi: 10.1111/j.1365-2893.2010.01346.x. Epub 2010 Jul 19.
Entrez:20642484

siRNA sequence "gucuguacagcaucuugag" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gucuguacagcaucuugag" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1077 " record
Length: 19
GC Content:47 %
Starting position: 767
Transfection Reagent: Polymer Polyethylenimine (PEI)
Incubation Time (Hours):48

Offtargets for "gucuguacagcaucuugag" siRNA in Human Genome sequences
See at Genbank
Pubmed:15756649
Article:Stable inhibition of hepatitis B virus proteins by small interfering RNA expressed from viral vectors.
Authors:Moore MD, McGarvey MJ, Russell RA, Cullen BR, McClure MO.
Journal:J Gene Med. 2005 Jul;7(7):918-25.
Entrez:15756649

siRNA sequence "cuaccgugugucuuggcca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "cuaccgugugucuuggcca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1073 " record
Length: 19
GC Content:58 %
Starting position: 290
Transfection Reagent: Polymer Polyethylenimine (PEI)
Incubation Time (Hours):48

Offtargets for "cuaccgugugucuuggcca" siRNA in Human Genome sequences
See at Genbank
Pubmed:15756649
Article:Stable inhibition of hepatitis B virus proteins by small interfering RNA expressed from viral vectors.
Authors:Moore MD, McGarvey MJ, Russell RA, Cullen BR, McClure MO.
Journal:J Gene Med. 2005 Jul;7(7):918-25.
Entrez:15756649

siRNA sequence "ccuagaagaagaacucccucgccuc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ccuagaagaagaacucccucgccuc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1445 " record
Length: 25
GC Content:56 %
Incubation Time (Hours):168

Offtargets for "ccuagaagaagaacucccucgccuc" siRNA in Human Genome sequences
See at Genbank
Pubmed:19804649
Article:Hepatitis B virus inhibition in mice by lentiviral vector mediated short hairpin RNA.
Authors:Deng L, Li G, Xi L, Yin A, Gao Y, You W, Wang X, Sun B.
Journal:BMC Gastroenterol. 2009 Oct 6;9:73.
Entrez:19804649

siRNA sequence "gaauccucacaauaccgca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gaauccucacaauaccgca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1070 " record
Length: 19
GC Content:47 %
Starting position: 227
Transfection Reagent: Polymer Polyethylenimine (PEI)
Incubation Time (Hours):48

Offtargets for "gaauccucacaauaccgca" siRNA in Human Genome sequences
See at Genbank
Pubmed:15756649
Article:Stable inhibition of hepatitis B virus proteins by small interfering RNA expressed from viral vectors.
Authors:Moore MD, McGarvey MJ, Russell RA, Cullen BR, McClure MO.
Journal:J Gene Med. 2005 Jul;7(7):918-25.
Entrez:15756649

siRNA sequence "auccagauugggacuucaa" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "auccagauugggacuucaa" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1961 " record
Length: 19
GC Content:42 %
Starting position: 2935
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "auccagauugggacuucaa" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:20642484
Article:Knockdown of HBV surface antigen gene expression by a lentiviral microRNA-based system inhibits HBV replication and HCC growth.
Authors:Xiangji L, Feng X, Qingbao C, Weifeng T, Xiaoqing J, Baihe Z, Feng S, Hongyang W, Mengchao W.
Journal:J Viral Hepat. 2011 Sep;18(9):653-60. doi: 10.1111/j.1365-2893.2010.01346.x. Epub 2010 Jul 19.
Entrez:20642484

siRNA sequence "ccuccuguccuccaacuug" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ccuccuguccuccaacuug" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1075 " record
Length: 19
GC Content:58 %
Starting position: 344
Transfection Reagent: Polymer Polyethylenimine (PEI)
Incubation Time (Hours):48

Offtargets for "ccuccuguccuccaacuug" siRNA in Human Genome sequences
See at Genbank
Pubmed:15756649
Article:Stable inhibition of hepatitis B virus proteins by small interfering RNA expressed from viral vectors.
Authors:Moore MD, McGarvey MJ, Russell RA, Cullen BR, McClure MO.
Journal:J Gene Med. 2005 Jul;7(7):918-25.
Entrez:15756649

siRNA sequence "uauacaucguuuccauggc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "uauacaucguuuccauggc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1078 " record
Length: 19
GC Content:42 %
Starting position: 1362
Transfection Reagent: Polymer Polyethylenimine (PEI)
Incubation Time (Hours):48

Offtargets for "uauacaucguuuccauggc" siRNA in Human Genome sequences
See at Genbank
Pubmed:15756649
Article:Stable inhibition of hepatitis B virus proteins by small interfering RNA expressed from viral vectors.
Authors:Moore MD, McGarvey MJ, Russell RA, Cullen BR, McClure MO.
Journal:J Gene Med. 2005 Jul;7(7):918-25.
Entrez:15756649

siRNA sequence "uccucacaauaccgcagag" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "uccucacaauaccgcagag" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1071 " record
Length: 19
GC Content:53 %
Starting position: 230
Transfection Reagent: Polymer Polyethylenimine (PEI)
Incubation Time (Hours):48

Offtargets for "uccucacaauaccgcagag" siRNA in Human Genome sequences
See at Genbank
Pubmed:15756649
Article:Stable inhibition of hepatitis B virus proteins by small interfering RNA expressed from viral vectors.
Authors:Moore MD, McGarvey MJ, Russell RA, Cullen BR, McClure MO.
Journal:J Gene Med. 2005 Jul;7(7):918-25.
Entrez:15756649

siRNA sequence "ucacucaccaaccuccugu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ucacucaccaaccuccugu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1074 " record
Length: 19
GC Content:53 %
Starting position: 333
Transfection Reagent: Polymer Polyethylenimine (PEI)
Incubation Time (Hours):48

Offtargets for "ucacucaccaaccuccugu" siRNA in Human Genome sequences
See at Genbank
Pubmed:15756649
Article:Stable inhibition of hepatitis B virus proteins by small interfering RNA expressed from viral vectors.
Authors:Moore MD, McGarvey MJ, Russell RA, Cullen BR, McClure MO.
Journal:J Gene Med. 2005 Jul;7(7):918-25.
Entrez:15756649

siRNA sequence "caucacaucaggauuccua" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "caucacaucaggauuccua" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1069 " record
Length: 19
GC Content:42 %
Starting position: 165
Transfection Reagent: Polymer Polyethylenimine (PEI)
Incubation Time (Hours):48

Offtargets for "caucacaucaggauuccua" siRNA in Human Genome sequences
See at Genbank
Pubmed:15756649
Article:Stable inhibition of hepatitis B virus proteins by small interfering RNA expressed from viral vectors.
Authors:Moore MD, McGarvey MJ, Russell RA, Cullen BR, McClure MO.
Journal:J Gene Med. 2005 Jul;7(7):918-25.
Entrez:15756649

siRNA sequence "uaccgcagagucuagacuc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "uaccgcagagucuagacuc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1072 " record
Length: 19
GC Content:53 %
Starting position: 239
Transfection Reagent: Polymer Polyethylenimine (PEI)
Incubation Time (Hours):48

Offtargets for "uaccgcagagucuagacuc" siRNA in Human Genome sequences
See at Genbank
Pubmed:15756649
Article:Stable inhibition of hepatitis B virus proteins by small interfering RNA expressed from viral vectors.
Authors:Moore MD, McGarvey MJ, Russell RA, Cullen BR, McClure MO.
Journal:J Gene Med. 2005 Jul;7(7):918-25.
Entrez:15756649

siRNA sequence "uuccuaugggagugggccu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "uuccuaugggagugggccu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1076 " record
Length: 19
GC Content:58 %
Starting position: 637
Transfection Reagent: Polymer Polyethylenimine (PEI)
Incubation Time (Hours):48

Offtargets for "uuccuaugggagugggccu" siRNA in Human Genome sequences
See at Genbank
Pubmed:15756649
Article:Stable inhibition of hepatitis B virus proteins by small interfering RNA expressed from viral vectors.
Authors:Moore MD, McGarvey MJ, Russell RA, Cullen BR, McClure MO.
Journal:J Gene Med. 2005 Jul;7(7):918-25.
Entrez:15756649

siRNA sequence "ugucaacgaccgaccuuga" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ugucaacgaccgaccuuga" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1068 " record
Length: 19
GC Content:53 %
Starting position: 1683
Transfection Reagent: Polymer Polyethylenimine (PEI)
Incubation Time (Hours):48

Offtargets for "ugucaacgaccgaccuuga" siRNA in Human Genome sequences
See at Genbank
Pubmed:15756649
Article:Stable inhibition of hepatitis B virus proteins by small interfering RNA expressed from viral vectors.
Authors:Moore MD, McGarvey MJ, Russell RA, Cullen BR, McClure MO.
Journal:J Gene Med. 2005 Jul;7(7):918-25.
Entrez:15756649

siRNA sequence "ucaucucuuguucaugucc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ucaucucuuguucaugucc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1079 " record
Length: 19
GC Content:42 %
Starting position: 1841
Transfection Reagent: Polymer Polyethylenimine (PEI)
Incubation Time (Hours):48

Offtargets for "ucaucucuuguucaugucc" siRNA in Human Genome sequences
See at Genbank
Pubmed:15756649
Article:Stable inhibition of hepatitis B virus proteins by small interfering RNA expressed from viral vectors.
Authors:Moore MD, McGarvey MJ, Russell RA, Cullen BR, McClure MO.
Journal:J Gene Med. 2005 Jul;7(7):918-25.
Entrez:15756649

siRNA sequence "gcucccgcgugucuuggcc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gcucccgcgugucuuggcc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1307 " record
Length: 19
GC Content:74 %
Starting position: 287
Strain of Virus: ayw
GenBank Acc: AB048705
Transfection Reagent: Sofast
Incubation Time (Hours):48

Offtargets for "gcucccgcgugucuuggcc" siRNA in Human Genome sequences
See AB048705 at Genbank
Pubmed:16022904
Article:Inhibition of Hepatitis B virus gene expression by single and dual small interfering RNA treatment.
Authors:Wu KL, Zhang X, Zhang J, Yang Y, Mu YX, Liu M, Lu L, Li Y, Zhu Y, Wu J.
Journal:Virus Res. 2005 Sep;112(1-2):100-7. Epub 2005 Apr 26.
Entrez:16022904

siRNA sequence "gguggacuucucucaauuu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gguggacuucucucaauuu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1308 " record
Length: 19
GC Content:42 %
Starting position: 258
Strain of Virus: ayw
GenBank Acc: AB048705
Transfection Reagent: Sofast
Incubation Time (Hours):48

Offtargets for "gguggacuucucucaauuu" siRNA in Human Genome sequences
See AB048705 at Genbank
Pubmed:16022904
Article:Inhibition of Hepatitis B virus gene expression by single and dual small interfering RNA treatment.
Authors:Wu KL, Zhang X, Zhang J, Yang Y, Mu YX, Liu M, Lu L, Li Y, Zhu Y, Wu J.
Journal:Virus Res. 2005 Sep;112(1-2):100-7. Epub 2005 Apr 26.
Entrez:16022904

siRNA sequence "gcaaugucaacgaccgacc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gcaaugucaacgaccgacc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1313 " record
Length: 19
GC Content:58 %
Starting position: 1679
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Sofast
Incubation Time (Hours):48

Offtargets for "gcaaugucaacgaccgacc" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16022904
Article:Inhibition of Hepatitis B virus gene expression by single and dual small interfering RNA treatment.
Authors:Wu KL, Zhang X, Zhang J, Yang Y, Mu YX, Liu M, Lu L, Li Y, Zhu Y, Wu J.
Journal:Virus Res. 2005 Sep;112(1-2):100-7. Epub 2005 Apr 26.
Entrez:16022904

siRNA sequence "gccaaaauucgcaguccc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gccaaaauucgcaguccc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1309 " record
Length: 18
GC Content:56 %
Starting position: 305
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Sofast
Incubation Time (Hours):48

Offtargets for "gccaaaauucgcaguccc" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16022904
Article:Inhibition of Hepatitis B virus gene expression by single and dual small interfering RNA treatment.
Authors:Wu KL, Zhang X, Zhang J, Yang Y, Mu YX, Liu M, Lu L, Li Y, Zhu Y, Wu J.
Journal:Virus Res. 2005 Sep;112(1-2):100-7. Epub 2005 Apr 26.
Entrez:16022904

siRNA sequence "gcucaguuuacuagugcca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gcucaguuuacuagugcca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1311 " record
Length: 19
GC Content:47 %
Starting position: 672
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Sofast
Incubation Time (Hours):48

Offtargets for "gcucaguuuacuagugcca" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16022904
Article:Inhibition of Hepatitis B virus gene expression by single and dual small interfering RNA treatment.
Authors:Wu KL, Zhang X, Zhang J, Yang Y, Mu YX, Liu M, Lu L, Li Y, Zhu Y, Wu J.
Journal:Virus Res. 2005 Sep;112(1-2):100-7. Epub 2005 Apr 26.
Entrez:16022904

siRNA sequence "gcacuucgcuucaccucug" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gcacuucgcuucaccucug" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1312 " record
Length: 19
GC Content:58 %
Starting position: 1583
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Sofast
Incubation Time (Hours):48

Offtargets for "gcacuucgcuucaccucug" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16022904
Article:Inhibition of Hepatitis B virus gene expression by single and dual small interfering RNA treatment.
Authors:Wu KL, Zhang X, Zhang J, Yang Y, Mu YX, Liu M, Lu L, Li Y, Zhu Y, Wu J.
Journal:Virus Res. 2005 Sep;112(1-2):100-7. Epub 2005 Apr 26.
Entrez:16022904

siRNA sequence "guugcuguaccaaaccuu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "guugcuguaccaaaccuu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1310 " record
Length: 18
GC Content:44 %
Starting position: 566
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Sofast
Incubation Time (Hours):48

Offtargets for "guugcuguaccaaaccuu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16022904
Article:Inhibition of Hepatitis B virus gene expression by single and dual small interfering RNA treatment.
Authors:Wu KL, Zhang X, Zhang J, Yang Y, Mu YX, Liu M, Lu L, Li Y, Zhu Y, Wu J.
Journal:Virus Res. 2005 Sep;112(1-2):100-7. Epub 2005 Apr 26.
Entrez:16022904


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1959	auuccuaugggagugggcc	Hepatitis B Virus [HBV]	S	293T	Protein	Low	20642484	Blast SL	refseqs
virsi1446	cucaguuuacuagugccauuuguuc	Hepatitis B Virus [HBV]	C	293T	Protein	90	19804649	Blast SL	refseqs
virsi1067	gguauguugcccguuuguc	Hepatitis B Virus [HBV]	S	293T	Protein	81	15756649	Blast SL	refseqs
virsi1960	gguauguugcccguuuguc	Hepatitis B Virus [HBV]	S	293T	Protein	80	20642484	Blast SL	refseqs
virsi1077	gucuguacagcaucuugag	Hepatitis B Virus [HBV]	S	293T	Protein	78	15756649	Blast SL	refseqs
virsi1073	cuaccgugugucuuggcca	Hepatitis B Virus [HBV]	S	293T	Protein	74	15756649	Blast SL	refseqs
virsi1445	ccuagaagaagaacucccucgccuc	Hepatitis B Virus [HBV]	P	293T	Protein	68	19804649	Blast SL	refseqs
virsi1070	gaauccucacaauaccgca	Hepatitis B Virus [HBV]	S	293T	Protein	68	15756649	Blast SL	refseqs
virsi1961	auccagauugggacuucaa	Hepatitis B Virus [HBV]	S	293T	Protein	50	20642484	Blast SL	refseqs
virsi1075	ccuccuguccuccaacuug	Hepatitis B Virus [HBV]	S	293T	Protein	49	15756649	Blast SL	refseqs
virsi1078	uauacaucguuuccauggc	Hepatitis B Virus [HBV]	S	293T	Protein	42	15756649	Blast SL	refseqs
virsi1071	uccucacaauaccgcagag	Hepatitis B Virus [HBV]	S	293T	Protein	23	15756649	Blast SL	refseqs
virsi1074	ucacucaccaaccuccugu	Hepatitis B Virus [HBV]	S	293T	Protein	21	15756649	Blast SL	refseqs
virsi1069	caucacaucaggauuccua	Hepatitis B Virus [HBV]	S	293T	Protein	6	15756649	Blast SL	refseqs
virsi1072	uaccgcagagucuagacuc	Hepatitis B Virus [HBV]	S	293T	Protein	6	15756649	Blast SL	refseqs
virsi1076	uuccuaugggagugggccu	Hepatitis B Virus [HBV]	S	293T	Protein	1	15756649	Blast SL	refseqs
virsi1068	ugucaacgaccgaccuuga	Hepatitis B Virus [HBV]	S	293T	Protein	0	15756649	Blast SL	refseqs
virsi1079	ucaucucuuguucaugucc	Hepatitis B Virus [HBV]	S	293T	Protein	0	15756649	Blast SL	refseqs
virsi1307	gcucccgcgugucuuggcc	Hepatitis B Virus [HBV]	S	BEL-7402	Protein	82	16022904	Blast SL	refseqs
virsi1308	gguggacuucucucaauuu	Hepatitis B Virus [HBV]	S	BEL-7402	Protein	80	16022904	Blast SL	refseqs
virsi1313	gcaaugucaacgaccgacc	Hepatitis B Virus [HBV]	X	BEL-7402	Protein	77	16022904	Blast SL	refseqs
virsi1309	gccaaaauucgcaguccc	Hepatitis B Virus [HBV]	S	BEL-7402	Protein	37	16022904	Blast SL	refseqs
virsi1311	gcucaguuuacuagugcca	Hepatitis B Virus [HBV]	S	BEL-7402	Protein	16	16022904	Blast SL	refseqs
virsi1312	gcacuucgcuucaccucug	Hepatitis B Virus [HBV]	X	BEL-7402	Protein	13	16022904	Blast SL	refseqs
virsi1310	guugcuguaccaaaccuu	Hepatitis B Virus [HBV]	S	BEL-7402	Protein	2	16022904	Blast SL	refseqs



« previous12345678910next »

: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm