VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for Human Papillomavirus [HPV] are 89
Results from 0 - 25

« previous1234next »
siRNA sequence "aagagcugaaacaacuauac" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "aagagcugaaacaacuauac" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi2181 " record
Length: 20
GC Content:35 %
Strain of Virus: 16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48

Offtargets for "aagagcugaaacaacuauac" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:15763658
Article:Human papillomavirus-16 associated squamous cell carcinoma of the head and neck (SCCHN): a natural disease model provides insights into viral carcinogenesis.
Authors:Ferris RL, Martinez I, Sirianni N, Wang J, López-Albaitero A, Gollin SM, Johnson JT, Khan S.
Journal:Eur J Cancer. 2005 Mar;41(5):807-15.
Entrez:15763658

siRNA sequence "aacugcgacgugagguauaug" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "aacugcgacgugagguauaug" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi2182 " record
Length: 21
GC Content:48 %
Strain of Virus: 16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48

Offtargets for "aacugcgacgugagguauaug" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:15763658
Article:Human papillomavirus-16 associated squamous cell carcinoma of the head and neck (SCCHN): a natural disease model provides insights into viral carcinogenesis.
Authors:Ferris RL, Martinez I, Sirianni N, Wang J, López-Albaitero A, Gollin SM, Johnson JT, Khan S.
Journal:Eur J Cancer. 2005 Mar;41(5):807-15.
Entrez:15763658

siRNA sequence "acccuacaagcuaccugau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "acccuacaagcuaccugau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1719 " record
Length: 19
GC Content:47 %
Starting position: 134
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Surefector
Incubation Time (Hours):36

Offtargets for "acccuacaagcuaccugau" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:16865269
Article:Intratumor injection of small interfering RNA-targeting human papillomavirus 18 E6 and E7 successfully inhibits the growth of cervical cancer.
Authors:Fujii T, Saito M, Iwasaki E, Ochiya T, Takei Y, Hayashi S, Ono A, Hirao N, Nakamura M, Kubushiro K, Tsukazaki K, Aoki D.
Journal:Int J Oncol. 2006 Sep;29(3):541-8.
Entrez:16865269

siRNA sequence "uguguguacugcaagcaac" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "uguguguacugcaagcaac" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1720 " record
Length: 19
GC Content:47 %
Starting position: 191
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Genejammer
Incubation Time (Hours):14 Days

Offtargets for "uguguguacugcaagcaac" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16681752
Article:Extended effects of human papillomavirus 16 E6-specific short hairpin RNA on cervical carcinoma cells.
Authors:Bai L, Wei L, Wang J, Li X, He P.
Journal:Int J Gynecol Cancer. 2006 Mar-Apr;16(2):718-29.
Entrez:16681752

siRNA sequence "aggaggaugaaauagaugg" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "aggaggaugaaauagaugg" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1767 " record
Length: 19
GC Content:42 %
Starting position: 662
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72

Offtargets for "aggaggaugaaauagaugg" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:15665592
Article:Gel-based application of siRNA to human epithelial cancer cells induces RNAi-dependent apoptosis.
Authors:Jiang M, Rubbi CP, Milner J.
Journal:Oligonucleotides. 2004 Winter;14(4):239-48.
Entrez:15665592

siRNA sequence "caguuacugcgacgugaggu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "caguuacugcgacgugaggu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1721 " record
Length: 20
GC Content:55 %
Starting position: 209
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Genejammer
Incubation Time (Hours):14 Days

Offtargets for "caguuacugcgacgugaggu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16681752
Article:Extended effects of human papillomavirus 16 E6-specific short hairpin RNA on cervical carcinoma cells.
Authors:Bai L, Wei L, Wang J, Li X, He P.
Journal:Int J Gynecol Cancer. 2006 Mar-Apr;16(2):718-29.
Entrez:16681752

siRNA sequence "cuucgguugugcguacaaagc" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cuucgguugugcguacaaagc" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1760 " record
Length: 21
GC Content:52 %
Starting position: 754
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "cuucgguugugcguacaaagc" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144

siRNA sequence "gcccauuacaauauuguaacc" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcccauuacaauauuguaacc" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1759 " record
Length: 21
GC Content:38 %
Starting position: 709
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gcccauuacaauauuguaacc" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144

siRNA sequence "gaccggucgauguaugucuug" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gaccggucgauguaugucuug" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1756 " record
Length: 21
GC Content:52 %
Starting position: 499
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gaccggucgauguaugucuug" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144

siRNA sequence "caccuacauugcaugaauaua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "caccuacauugcaugaauaua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1761 " record
Length: 21
GC Content:33 %
Starting position: 575
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "caccuacauugcaugaauaua" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144

siRNA sequence "ccggacagagcccauuacaau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ccggacagagcccauuacaau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1758 " record
Length: 21
GC Content:52 %
Starting position: 700
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "ccggacagagcccauuacaau" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144

siRNA sequence "ggucgauguaugucuuguugc" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ggucgauguaugucuuguugc" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1757 " record
Length: 21
GC Content:48 %
Starting position: 503
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "ggucgauguaugucuuguugc" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144

siRNA sequence "gguggaccggucgauguaugu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gguggaccggucgauguaugu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1755 " record
Length: 21
GC Content:57 %
Starting position: 495
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gguggaccggucgauguaugu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144

siRNA sequence "gggauuuaugcauaguauaua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gggauuuaugcauaguauaua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1754 " record
Length: 21
GC Content:29 %
Starting position: 246
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gggauuuaugcauaguauaua" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144

siRNA sequence "accguugugugauuuguua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "accguugugugauuuguua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1722 " record
Length: 19
GC Content:37 %
Starting position: 385
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Genejammer
Incubation Time (Hours):14 Days

Offtargets for "accguugugugauuuguua" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16681752
Article:Extended effects of human papillomavirus 16 E6-specific short hairpin RNA on cervical carcinoma cells.
Authors:Bai L, Wei L, Wang J, Li X, He P.
Journal:Int J Gynecol Cancer. 2006 Mar-Apr;16(2):718-29.
Entrez:16681752

siRNA sequence "guaaccgaaaucgguugaacc" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "guaaccgaaaucgguugaacc" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1769 " record
Length: 21
GC Content:48 %
Starting position: 32
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Codebreaker
Incubation Time (Hours):48

Offtargets for "guaaccgaaaucgguugaacc" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:19826423
Article:Gene silencing of HPV16 E6/E7 induced by promoter-targeting siRNA in SiHa cells.
Authors:Hong D, Lu W, Ye F, Hu Y, Xie X.
Journal:Br J Cancer. 2009 Nov 17;101(10):1798-804. Epub 2009 Oct 13.
Entrez:19826423

siRNA sequence "cgggauuuaugcauaguauau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cgggauuuaugcauaguauau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1753 " record
Length: 21
GC Content:33 %
Starting position: 245
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "cgggauuuaugcauaguauau" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144

siRNA sequence "cuuugcuuuucgggauuuaug" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cuuugcuuuucgggauuuaug" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1752 " record
Length: 21
GC Content:38 %
Starting position: 235
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "cuuugcuuuucgggauuuaug" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144

siRNA sequence "gcaaagacaucuggacaaa" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcaaagacaucuggacaaa" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1723 " record
Length: 19
GC Content:42 %
Starting position: 448
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Genejammer
Incubation Time (Hours):14 Days

Offtargets for "gcaaagacaucuggacaaa" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16681752
Article:Extended effects of human papillomavirus 16 E6-specific short hairpin RNA on cervical carcinoma cells.
Authors:Bai L, Wei L, Wang J, Li X, He P.
Journal:Int J Gynecol Cancer. 2006 Mar-Apr;16(2):718-29.
Entrez:16681752

siRNA sequence "ccuguguauauugcaagac" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ccuguguauauugcaagac" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1701 " record
Length: 19
GC Content:42 %
Starting position: 196
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48

Offtargets for "ccuguguauauugcaagac" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:16138119
Article:Induction of cell death in human papillomavirus 18-positive cervical cancer cells by E6 siRNA.
Authors:Yamato K, Fen J, Kobuchi H, Nasu Y, Yamada T, Nishihara T, Ikeda Y, Kizaki M, Yoshinouchi M.
Journal:Cancer Gene Ther. 2006 Mar;13(3):234-41.
Entrez:16138119

siRNA sequence "gagguauuugaauuugcau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gagguauuugaauuugcau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1700 " record
Length: 19
GC Content:32 %
Starting position: 231
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48

Offtargets for "gagguauuugaauuugcau" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:16138119
Article:Induction of cell death in human papillomavirus 18-positive cervical cancer cells by E6 siRNA.
Authors:Yamato K, Fen J, Kobuchi H, Nasu Y, Yamada T, Nishihara T, Ikeda Y, Kizaki M, Yoshinouchi M.
Journal:Cancer Gene Ther. 2006 Mar;13(3):234-41.
Entrez:16138119

siRNA sequence "agguauuugaauuugcauu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "agguauuugaauuugcauu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1733 " record
Length: 19
GC Content:26 %
Starting position: 232
Strain of Virus: HPV18
GenBank Acc: NC_001357
Incubation Time (Hours):48

Offtargets for "agguauuugaauuugcauu" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:16810314
Article:Inhibition of cervical cancer cell growth in vitro and in vivo with lentiviral-vector delivered short hairpin RNA targeting human papillomavirus E6 and E7 oncogenes.
Authors:Gu W, Putral L, Hengst K, Minto K, Saunders NA, Leggatt G, McMillan NA.
Journal:Cancer Gene Ther. 2006 Nov;13(11):1023-32. Epub 2006 Jun 30.
Entrez:16810314

siRNA sequence "uaaccuguguauauugcaa" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi2352 " record
Length: 19
GC Content:32 %
Strain of Virus: HPV18
Transfection Reagent: Oligofectamine

Offtargets for "uaaccuguguauauugcaa" siRNA in Human Genome sequences
See at Genbank
Pubmed:21630254
Article:The synergistic therapeutic effect of cisplatin with Human papillomavirus E6/E7 short interfering RNA on cervical cancer cell lines in vitro and in vivo.
Authors:Jung HS, Erkin OC, Kwon MJ, Kim SH, Jung JI, Oh YK, Her SW, Ju W, Choi YL, Song SY, Kim JK, Kim YD, Shim GY, Shin YK. Int J Cancer. 2011 May 31. doi: 10.1002/ijc.26197. [Epub ahead of print] Int J Cancer. 2011 21630254
Journal:
Entrez:

siRNA sequence "cuaacuaacacuggguuau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi2353 " record
Length: 19
GC Content:37 %
Strain of Virus: HPV18
Transfection Reagent: Oligofectamine

Offtargets for "cuaacuaacacuggguuau" siRNA in Human Genome sequences
See at Genbank
Pubmed:21630254
Article:The synergistic therapeutic effect of cisplatin with Human papillomavirus E6/E7 short interfering RNA on cervical cancer cell lines in vitro and in vivo.
Authors:Jung HS, Erkin OC, Kwon MJ, Kim SH, Jung JI, Oh YK, Her SW, Ju W, Choi YL, Song SY, Kim JK, Kim YD, Shim GY, Shin YK. Int J Cancer. 2011 May 31. doi: 10.1002/ijc.26197. [Epub ahead of print] Int J Cancer. 2011 21630254
Journal:
Entrez:

siRNA sequence "gacauuauucagacucugu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gacauuauucagacucugu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1728 " record
Length: 19
GC Content:37 %
Starting position: 340
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):96

Offtargets for "gacauuauucagacucugu" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:15908516
Article:Chemotherapy compounds in cervical cancer cells primed by reconstitution of p53 function after short interfering RNA-mediated degradation of human papillomavirus 18 E6 mRNA: opposite effect of siRNA in combination with different drugs.
Authors:Koivusalo R, Krausz E, Helenius H, Hietanen S.
Journal:Mol Pharmacol. 2005 Aug;68(2):372-82. Epub 2005 May 20.
Entrez:15908516


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi2181	aagagcugaaacaacuauac	Human Papillomavirus [HPV]	E6	Upci:Scc090	mRNA	Medium	15763658	Blast SL	refseqs
virsi2182	aacugcgacgugagguauaug	Human Papillomavirus [HPV]	E6	Upci:Scc090	mRNA	High	15763658	Blast SL	refseqs
virsi1719	acccuacaagcuaccugau	Human Papillomavirus [HPV]	E6 / E7	SKG-II	mRNA	60	16865269	Blast SL	refseqs
virsi1720	uguguguacugcaagcaac	Human Papillomavirus [HPV]	E6	SiHa	mRNA	90	16681752	Blast SL	refseqs
virsi1767	aggaggaugaaauagaugg	Human Papillomavirus [HPV]	E7	SiHa	mRNA	85	15665592	Blast SL	refseqs
virsi1721	caguuacugcgacgugaggu	Human Papillomavirus [HPV]	E6	SiHa	mRNA	85	16681752	Blast SL	refseqs
virsi1760	cuucgguugugcguacaaagc	Human Papillomavirus [HPV]	E7	SiHa	mRNA	76	18157144	Blast SL	refseqs
virsi1759	gcccauuacaauauuguaacc	Human Papillomavirus [HPV]	E7	SiHa	mRNA	74	18157144	Blast SL	refseqs
virsi1756	gaccggucgauguaugucuug	Human Papillomavirus [HPV]	E6	SiHa	mRNA	73	18157144	Blast SL	refseqs
virsi1761	caccuacauugcaugaauaua	Human Papillomavirus [HPV]	E7	SiHa	mRNA	71	18157144	Blast SL	refseqs
virsi1758	ccggacagagcccauuacaau	Human Papillomavirus [HPV]	E7	SiHa	mRNA	68	18157144	Blast SL	refseqs
virsi1757	ggucgauguaugucuuguugc	Human Papillomavirus [HPV]	E6	SiHa	mRNA	58	18157144	Blast SL	refseqs
virsi1755	gguggaccggucgauguaugu	Human Papillomavirus [HPV]	E6	SiHa	mRNA	54	18157144	Blast SL	refseqs
virsi1754	gggauuuaugcauaguauaua	Human Papillomavirus [HPV]	E6	SiHa	mRNA	53	18157144	Blast SL	refseqs
virsi1722	accguugugugauuuguua	Human Papillomavirus [HPV]	E6	SiHa	mRNA	53	16681752	Blast SL	refseqs
virsi1769	guaaccgaaaucgguugaacc	Human Papillomavirus [HPV]	P97 of E6/E7	SiHa	mRNA	50	19826423	Blast SL	refseqs
virsi1753	cgggauuuaugcauaguauau	Human Papillomavirus [HPV]	E6	SiHa	mRNA	37	18157144	Blast SL	refseqs
virsi1752	cuuugcuuuucgggauuuaug	Human Papillomavirus [HPV]	E6	SiHa	mRNA	36	18157144	Blast SL	refseqs
virsi1723	gcaaagacaucuggacaaa	Human Papillomavirus [HPV]	E6	SiHa	mRNA	30	16681752	Blast SL	refseqs
virsi1701	ccuguguauauugcaagac	Human Papillomavirus [HPV]	E6	HeLa/SW756	mRNA	97	16138119	Blast SL	refseqs
virsi1700	gagguauuugaauuugcau	Human Papillomavirus [HPV]	E6	HeLa/SW756	mRNA	96	16138119	Blast SL	refseqs
virsi1733	agguauuugaauuugcauu	Human Papillomavirus [HPV]	E6	HeLa	Protein	Medium	16810314	Blast SL	refseqs
virsi2352	uaaccuguguauauugcaa	Human Papillomavirus [HPV]	E6 / E7	HeLa	mRNA	Medium	21630254	Blast SL	refseqs
virsi2353	cuaacuaacacuggguuau	Human Papillomavirus [HPV]	E6	HeLa	mRNA	Medium	21630254	Blast SL	refseqs
virsi1728	gacauuauucagacucugu	Human Papillomavirus [HPV]	E6	HeLa	mRNA	Low	15908516	Blast SL	refseqs



« previous1234next »

: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm