VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for Human Papillomavirus [HPV] are 89
Results from 0 - 25

« previous1234next »
siRNA sequence "agguauuugaauuugcauu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "agguauuugaauuugcauu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1763 " record
Length: 19
GC Content:26 %
Starting position: 232
Strain of Virus: HPV18
GenBank Acc: NC_001526
Incubation Time (Hours):72

Offtargets for "agguauuugaauuugcauu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18369785
Article:siRNA and shRNA as anticancer agents in a cervical cancer model.
Authors:Gu W, Putral L, McMillan N.
Journal:Methods Mol Biol. 2008;442:159-72.
Entrez:18369785

siRNA sequence "aggaggaugaaauagauggu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "aggaggaugaaauagauggu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1715 " record
Length: 20
GC Content:40 %
Starting position: 662
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24

Offtargets for "aggaggaugaaauagauggu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:19174559
Article:Inhibition of cervical cancer cell growth by human papillomavirus virus-like particles packaged with human papillomavirus oncoprotein short hairpin RNAs.
Authors:Bousarghin L, Touze A, Gaud G, Iochmann S, Alvarez E, Reverdiau P, Gaitan J, Jourdan ML, Sizaret PY, Coursaget PL.
Journal:Mol Cancer Ther. 2009 Feb;8(2):357-65. Epub 2009 Jan 27.
Entrez:19174559

siRNA sequence "gcccauuacaauauuguaac" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcccauuacaauauuguaac" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1714 " record
Length: 20
GC Content:35 %
Starting position: 709
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24

Offtargets for "gcccauuacaauauuguaac" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:19174559
Article:Inhibition of cervical cancer cell growth by human papillomavirus virus-like particles packaged with human papillomavirus oncoprotein short hairpin RNAs.
Authors:Bousarghin L, Touze A, Gaud G, Iochmann S, Alvarez E, Reverdiau P, Gaitan J, Jourdan ML, Sizaret PY, Coursaget PL.
Journal:Mol Cancer Ther. 2009 Feb;8(2):357-65. Epub 2009 Jan 27.
Entrez:19174559

siRNA sequence "agguauuugaauuugcauu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "agguauuugaauuugcauu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1733 " record
Length: 19
GC Content:26 %
Starting position: 232
Strain of Virus: HPV18
GenBank Acc: NC_001357
Incubation Time (Hours):48

Offtargets for "agguauuugaauuugcauu" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:16810314
Article:Inhibition of cervical cancer cell growth in vitro and in vivo with lentiviral-vector delivered short hairpin RNA targeting human papillomavirus E6 and E7 oncogenes.
Authors:Gu W, Putral L, Hengst K, Minto K, Saunders NA, Leggatt G, McMillan NA.
Journal:Cancer Gene Ther. 2006 Nov;13(11):1023-32. Epub 2006 Jun 30.
Entrez:16810314

siRNA sequence "gcaacaguuacugcgacgu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcaacaguuacugcgacgu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1762 " record
Length: 19
GC Content:53 %
Starting position: 205
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72

Offtargets for "gcaacaguuacugcgacgu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18369785
Article:siRNA and shRNA as anticancer agents in a cervical cancer model.
Authors:Gu W, Putral L, McMillan N.
Journal:Methods Mol Biol. 2008;442:159-72.
Entrez:18369785

siRNA sequence "cauuuaccagcccgacgag" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cauuuaccagcccgacgag" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1717 " record
Length: 19
GC Content:58 %
Starting position: 731
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72

Offtargets for "cauuuaccagcccgacgag" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:17589817
Article:Identification of cellular targets for the human papillomavirus E6 and E7 oncogenes by RNA interference and transcriptome analyses.
Authors:Kuner R, Vogt M, Sultmann H, Buness A, Dymalla S, Bulkescher J, Fellmann M, Butz K, Poustka A, Hoppe-Seyler F.
Journal:J Mol Med (Berl). 2007 Nov;85(11):1253-62. Epub 2007 Jun 23.
Entrez:17589817

siRNA sequence "cacuucacugcaagacaua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cacuucacugcaagacaua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1710 " record
Length: 19
GC Content:42 %
Starting position: 166
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72

Offtargets for "cacuucacugcaagacaua" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:17636212
Article:Silencing of HPV 18 oncoproteins With RNA interference causes growth inhibition of cervical cancer cells.
Authors:Lea JS, Sunaga N, Sato M, Kalahasti G, Miller DS, Minna JD, Muller CY.
Journal:Reprod Sci. 2007 Jan;14(1):20-8.
Entrez:17636212

siRNA sequence "ccaccaacgucacacaaugu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ccaccaacgucacacaaugu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1711 " record
Length: 20
GC Content:50 %
Starting position: 750
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Lipofectamine
Incubation Time (Hours):72

Offtargets for "ccaccaacgucacacaaugu" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:17636212
Article:Silencing of HPV 18 oncoproteins With RNA interference causes growth inhibition of cervical cancer cells.
Authors:Lea JS, Sunaga N, Sato M, Kalahasti G, Miller DS, Minna JD, Muller CY.
Journal:Reprod Sci. 2007 Jan;14(1):20-8.
Entrez:17636212

siRNA sequence "gcacacacguagacauucg" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcacacacguagacauucg" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi2167 " record
Length: 19
GC Content:53 %
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24

Offtargets for "gcacacacguagacauucg" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16611884
Article:The E7 oncoprotein is translated from spliced E6*I transcripts in high-risk human papillomavirus type 16- or type 18-positive cervical cancer cell lines via translation reinitiation.
Authors:Tang S, Tao M, McCoy JP Jr, Zheng ZM.
Journal:J Virol. 2006 May;80(9):4249-63.
Entrez:16611884

siRNA sequence "uggaguuaaucaucaacau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "uggaguuaaucaucaacau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi2170 " record
Length: 19
GC Content:32 %
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24

Offtargets for "uggaguuaaucaucaacau" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16611884
Article:The E7 oncoprotein is translated from spliced E6*I transcripts in high-risk human papillomavirus type 16- or type 18-positive cervical cancer cell lines via translation reinitiation.
Authors:Tang S, Tao M, McCoy JP Jr, Zheng ZM.
Journal:J Virol. 2006 May;80(9):4249-63.
Entrez:16611884

siRNA sequence "ccacaacgucacacaaugu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ccacaacgucacacaaugu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1718 " record
Length: 19
GC Content:47 %
Starting position: 755
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72

Offtargets for "ccacaacgucacacaaugu" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:17589817
Article:Identification of cellular targets for the human papillomavirus E6 and E7 oncogenes by RNA interference and transcriptome analyses.
Authors:Kuner R, Vogt M, Sultmann H, Buness A, Dymalla S, Bulkescher J, Fellmann M, Butz K, Poustka A, Hoppe-Seyler F.
Journal:J Mol Med (Berl). 2007 Nov;85(11):1253-62. Epub 2007 Jun 23.
Entrez:17589817

siRNA sequence "agguauuugaauuugcau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "agguauuugaauuugcau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1726 " record
Length: 18
GC Content:28 %
Starting position: 232
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24

Offtargets for "agguauuugaauuugcau" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:16120770
Article:RNA interference against human papillomavirus oncogenes in cervical cancer cells results in increased sensitivity to cisplatin.
Authors:Putral LN, Bywater MJ, Gu W, Saunders NA, Gabrielli BG, Leggatt GR, McMillan NA.
Journal:Mol Pharmacol. 2005 Nov;68(5):1311-9. Epub 2005 Aug 24.
Entrez:16120770

siRNA sequence "gcauggagauacaccuaca" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcauggagauacaccuaca" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1766 " record
Length: 19
GC Content:47 %
Starting position: 564
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine
Incubation Time (Hours):72

Offtargets for "gcauggagauacaccuaca" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18060502
Article:RNA interference against HPV16 E7 oncogene leads to viral E6 and E7 suppression in cervical cancer cells and apoptosis via upregulation of Rb and p53.
Authors:Sima N, Wang W, Kong D, Deng D, Xu Q, Zhou J, Xu G, Meng L, Lu Y, Wang S, Ma D.
Journal:Apoptosis. 2008 Feb;13(2):273-81.
Entrez:18060502

siRNA sequence "gcaacaguuacugcgacgu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcaacaguuacugcgacgu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1724 " record
Length: 19
GC Content:53 %
Starting position: 205
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24

Offtargets for "gcaacaguuacugcgacgu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16120770
Article:RNA interference against human papillomavirus oncogenes in cervical cancer cells results in increased sensitivity to cisplatin.
Authors:Putral LN, Bywater MJ, Gu W, Saunders NA, Gabrielli BG, Leggatt GR, McMillan NA.
Journal:Mol Pharmacol. 2005 Nov;68(5):1311-9. Epub 2005 Aug 24.
Entrez:16120770

siRNA sequence "cacguagagaaacccagcu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cacguagagaaacccagcu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1725 " record
Length: 19
GC Content:53 %
Starting position: 537
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24

Offtargets for "cacguagagaaacccagcu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16120770
Article:RNA interference against human papillomavirus oncogenes in cervical cancer cells results in increased sensitivity to cisplatin.
Authors:Putral LN, Bywater MJ, Gu W, Saunders NA, Gabrielli BG, Leggatt GR, McMillan NA.
Journal:Mol Pharmacol. 2005 Nov;68(5):1311-9. Epub 2005 Aug 24.
Entrez:16120770

siRNA sequence "gcacacacguagacauucg" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcacacacguagacauucg" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1768 " record
Length: 19
GC Content:53 %
Starting position: 773
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48

Offtargets for "gcacacacguagacauucg" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16369495
Article:Short-term induction and long-term suppression of HPV16 oncogene silencing by RNA interference in cervical cancer cells.
Authors:Tang S, Tao M, McCoy JP Jr, Zheng ZM.
Journal:Oncogene. 2006 Mar 30;25(14):2094-104.
Entrez:16369495

siRNA sequence "aacgaugaaauagauggag" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "aacgaugaaauagauggag" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1716 " record
Length: 19
GC Content:37 %
Starting position: 701
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72

Offtargets for "aacgaugaaauagauggag" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:17589817
Article:Identification of cellular targets for the human papillomavirus E6 and E7 oncogenes by RNA interference and transcriptome analyses.
Authors:Kuner R, Vogt M, Sultmann H, Buness A, Dymalla S, Bulkescher J, Fellmann M, Butz K, Poustka A, Hoppe-Seyler F.
Journal:J Mol Med (Berl). 2007 Nov;85(11):1253-62. Epub 2007 Jun 23.
Entrez:17589817

siRNA sequence "cagaaaaacuuagacaccu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cagaaaaacuuagacaccu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1734 " record
Length: 19
GC Content:37 %
Starting position: 448
Strain of Virus: HPV18
GenBank Acc: NC_001357
Incubation Time (Hours):48

Offtargets for "cagaaaaacuuagacaccu" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:16810314
Article:Inhibition of cervical cancer cell growth in vitro and in vivo with lentiviral-vector delivered short hairpin RNA targeting human papillomavirus E6 and E7 oncogenes.
Authors:Gu W, Putral L, Hengst K, Minto K, Saunders NA, Leggatt G, McMillan NA.
Journal:Cancer Gene Ther. 2006 Nov;13(11):1023-32. Epub 2006 Jun 30.
Entrez:16810314

siRNA sequence "aagagcugaaacaacuauac" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "aagagcugaaacaacuauac" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi2181 " record
Length: 20
GC Content:35 %
Strain of Virus: 16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48

Offtargets for "aagagcugaaacaacuauac" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:15763658
Article:Human papillomavirus-16 associated squamous cell carcinoma of the head and neck (SCCHN): a natural disease model provides insights into viral carcinogenesis.
Authors:Ferris RL, Martinez I, Sirianni N, Wang J, López-Albaitero A, Gollin SM, Johnson JT, Khan S.
Journal:Eur J Cancer. 2005 Mar;41(5):807-15.
Entrez:15763658

siRNA sequence "gggaauccauaugcuguaugu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gggaauccauaugcuguaugu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1705 " record
Length: 21
GC Content:43 %
Starting position: 272
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Calcium Phosohate
Incubation Time (Hours):24

Offtargets for "gggaauccauaugcuguaugu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:19276448
Article:E6 and e7 gene silencing and transformed phenotype of human papillomavirus 16-positive oropharyngeal cancer cells.
Authors:Rampias T, Sasaki C, Weinberger P, Psyrri A.
Journal:J Natl Cancer Inst. 2009 Mar 18;101(6):412-23. Epub 2009 Mar 10.
Entrez:19276448

siRNA sequence "aauguguguacugcaagcaac" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "aauguguguacugcaagcaac" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1707 " record
Length: 21
GC Content:43 %
Starting position: 189
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Calcium Phosohate
Incubation Time (Hours):24

Offtargets for "aauguguguacugcaagcaac" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:19276448
Article:E6 and e7 gene silencing and transformed phenotype of human papillomavirus 16-positive oropharyngeal cancer cells.
Authors:Rampias T, Sasaki C, Weinberger P, Psyrri A.
Journal:J Natl Cancer Inst. 2009 Mar 18;101(6):412-23. Epub 2009 Mar 10.
Entrez:19276448

siRNA sequence "ggacagagcccauuacaauau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ggacagagcccauuacaauau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1708 " record
Length: 21
GC Content:43 %
Starting position: 702
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Calcium Phosohate
Incubation Time (Hours):24

Offtargets for "ggacagagcccauuacaauau" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:19276448
Article:E6 and e7 gene silencing and transformed phenotype of human papillomavirus 16-positive oropharyngeal cancer cells.
Authors:Rampias T, Sasaki C, Weinberger P, Psyrri A.
Journal:J Natl Cancer Inst. 2009 Mar 18;101(6):412-23. Epub 2009 Mar 10.
Entrez:19276448

siRNA sequence "gcccauuacaauauuguaacc" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcccauuacaauauuguaacc" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1709 " record
Length: 21
GC Content:38 %
Starting position: 709
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Calcium Phosohate
Incubation Time (Hours):24

Offtargets for "gcccauuacaauauuguaacc" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:19276448
Article:E6 and e7 gene silencing and transformed phenotype of human papillomavirus 16-positive oropharyngeal cancer cells.
Authors:Rampias T, Sasaki C, Weinberger P, Psyrri A.
Journal:J Natl Cancer Inst. 2009 Mar 18;101(6):412-23. Epub 2009 Mar 10.
Entrez:19276448

siRNA sequence "ggucgauguaugucuuguugc" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ggucgauguaugucuuguugc" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1712 " record
Length: 21
GC Content:48 %
Starting position: 503
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24

Offtargets for "ggucgauguaugucuuguugc" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:19174559
Article:Inhibition of cervical cancer cell growth by human papillomavirus virus-like particles packaged with human papillomavirus oncoprotein short hairpin RNAs.
Authors:Bousarghin L, Touze A, Gaud G, Iochmann S, Alvarez E, Reverdiau P, Gaitan J, Jourdan ML, Sizaret PY, Coursaget PL.
Journal:Mol Cancer Ther. 2009 Feb;8(2):357-65. Epub 2009 Jan 27.
Entrez:19174559

siRNA sequence "uaaccuguguauauugcaa" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi2352 " record
Length: 19
GC Content:32 %
Strain of Virus: HPV18
Transfection Reagent: Oligofectamine

Offtargets for "uaaccuguguauauugcaa" siRNA in Human Genome sequences
See at Genbank
Pubmed:21630254
Article:The synergistic therapeutic effect of cisplatin with Human papillomavirus E6/E7 short interfering RNA on cervical cancer cell lines in vitro and in vivo.
Authors:Jung HS, Erkin OC, Kwon MJ, Kim SH, Jung JI, Oh YK, Her SW, Ju W, Choi YL, Song SY, Kim JK, Kim YD, Shim GY, Shin YK. Int J Cancer. 2011 May 31. doi: 10.1002/ijc.26197. [Epub ahead of print] Int J Cancer. 2011 21630254
Journal:
Entrez:


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1763	agguauuugaauuugcauu	Human Papillomavirus [HPV]	E6	HeLa	RNA	Low	18369785	Blast SL	refseqs
virsi1715	aggaggaugaaauagauggu	Human Papillomavirus [HPV]	E7	CaSki	RNA	100	19174559	Blast SL	refseqs
virsi1714	gcccauuacaauauuguaac	Human Papillomavirus [HPV]	E7	CaSki	RNA	50	19174559	Blast SL	refseqs
virsi1733	agguauuugaauuugcauu	Human Papillomavirus [HPV]	E6	HeLa	Protein	Medium	16810314	Blast SL	refseqs
virsi1762	gcaacaguuacugcgacgu	Human Papillomavirus [HPV]	E6	CaSki	Protein	Low	18369785	Blast SL	refseqs
virsi1717	cauuuaccagcccgacgag	Human Papillomavirus [HPV]	E7	HeLa	Protein	High	17589817	Blast SL	refseqs
virsi1710	cacuucacugcaagacaua	Human Papillomavirus [HPV]	E6	HeLa	Protein	High	17636212	Blast SL	refseqs
virsi1711	ccaccaacgucacacaaugu	Human Papillomavirus [HPV]	E7	HeLa	Protein	High	17636212	Blast SL	refseqs
virsi2167	gcacacacguagacauucg	Human Papillomavirus [HPV]	E7	CaSki	Protein	High	16611884	Blast SL	refseqs
virsi2170	uggaguuaaucaucaacau	Human Papillomavirus [HPV]	E6	CaSki	Protein	High	16611884	Blast SL	refseqs
virsi1718	ccacaacgucacacaaugu	Human Papillomavirus [HPV]	E7	HeLa	Protein	100	17589817	Blast SL	refseqs
virsi1726	agguauuugaauuugcau	Human Papillomavirus [HPV]	E6	CaSki	Protein	90	16120770	Blast SL	refseqs
virsi1766	gcauggagauacaccuaca	Human Papillomavirus [HPV]	E7	CaSki	Protein	88	18060502	Blast SL	refseqs
virsi1724	gcaacaguuacugcgacgu	Human Papillomavirus [HPV]	E6	CaSki	Protein	81	16120770	Blast SL	refseqs
virsi1725	cacguagagaaacccagcu	Human Papillomavirus [HPV]	E6	CaSki	Protein	79	16120770	Blast SL	refseqs
virsi1768	gcacacacguagacauucg	Human Papillomavirus [HPV]	E7	CaSki	Protein	77	16369495	Blast SL	refseqs
virsi1716	aacgaugaaauagauggag	Human Papillomavirus [HPV]	E7	HeLa	Protein	10	17589817	Blast SL	refseqs
virsi1734	cagaaaaacuuagacaccu	Human Papillomavirus [HPV]	E6	HeLa	Protein	0	16810314	Blast SL	refseqs
virsi2181	aagagcugaaacaacuauac	Human Papillomavirus [HPV]	E6	Upci:Scc090	mRNA	Medium	15763658	Blast SL	refseqs
virsi1705	gggaauccauaugcuguaugu	Human Papillomavirus [HPV]	E6 / E7	147T	mRNA	Medium	19276448	Blast SL	refseqs
virsi1707	aauguguguacugcaagcaac	Human Papillomavirus [HPV]	E6 / E7	147T	mRNA	Medium	19276448	Blast SL	refseqs
virsi1708	ggacagagcccauuacaauau	Human Papillomavirus [HPV]	E6 / E7	147T	mRNA	Medium	19276448	Blast SL	refseqs
virsi1709	gcccauuacaauauuguaacc	Human Papillomavirus [HPV]	E6 / E7	147T	mRNA	Medium	19276448	Blast SL	refseqs
virsi1712	ggucgauguaugucuuguugc	Human Papillomavirus [HPV]	E6	CaSki	mRNA	Medium	19174559	Blast SL	refseqs
virsi2352	uaaccuguguauauugcaa	Human Papillomavirus [HPV]	E6 / E7	HeLa	mRNA	Medium	21630254	Blast SL	refseqs



« previous1234next »

: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm