VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for K13 are 1
Results from 0 - 25

siRNA sequence "guguggguugagguaugaacacg" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1918 " record
Length: 23
GC Content:52 %
Starting position: 122857
Strain of Virus: HHV-8
GenBank Acc: AF148805
Incubation Time (Hours):72

Offtargets for "guguggguugagguaugaacacg" siRNA in Human Genome sequences
See AF148805 at Genbank
Pubmed:15190178
Article:Activation of alternative NF-kappa B pathway by human herpes virus 8-encoded Fas-associated death domain-like IL-1 beta-converting enzyme inhibitory protein (vFLIP).
Authors:Matta H, Chaudhary PM.
Journal:Proc Natl Acad Sci U S A. 2004 Jun 22;101(25):9399-404. Epub 2004 Jun 9.
Entrez:15190178


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1918	guguggguugagguaugaacacg	Herpes Simplex Virus [HSV]	K13	BC-3	Protein	80	15190178	Blast SL	refseqs



: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm