VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for Papillomaviridae are 87
Results from 25 - 50

« previous1234next »
siRNA sequence "ccuguguauauugcaagac" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ccuguguauauugcaagac" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1701 " record
Length: 19
GC Content:42 %
Starting position: 196
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48

Offtargets for "ccuguguauauugcaagac" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:16138119
Article:Induction of cell death in human papillomavirus 18-positive cervical cancer cells by E6 siRNA.
Authors:Yamato K, Fen J, Kobuchi H, Nasu Y, Yamada T, Nishihara T, Ikeda Y, Kizaki M, Yoshinouchi M.
Journal:Cancer Gene Ther. 2006 Mar;13(3):234-41.
Entrez:16138119

siRNA sequence "gagguauuugaauuugcau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gagguauuugaauuugcau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1700 " record
Length: 19
GC Content:32 %
Starting position: 231
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48

Offtargets for "gagguauuugaauuugcau" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:16138119
Article:Induction of cell death in human papillomavirus 18-positive cervical cancer cells by E6 siRNA.
Authors:Yamato K, Fen J, Kobuchi H, Nasu Y, Yamada T, Nishihara T, Ikeda Y, Kizaki M, Yoshinouchi M.
Journal:Cancer Gene Ther. 2006 Mar;13(3):234-41.
Entrez:16138119

siRNA sequence "agguauuugaauuugcau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "agguauuugaauuugcau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1726 " record
Length: 18
GC Content:28 %
Starting position: 232
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24

Offtargets for "agguauuugaauuugcau" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:16120770
Article:RNA interference against human papillomavirus oncogenes in cervical cancer cells results in increased sensitivity to cisplatin.
Authors:Putral LN, Bywater MJ, Gu W, Saunders NA, Gabrielli BG, Leggatt GR, McMillan NA.
Journal:Mol Pharmacol. 2005 Nov;68(5):1311-9. Epub 2005 Aug 24.
Entrez:16120770

siRNA sequence "uguguguacugcaagcaac" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "uguguguacugcaagcaac" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1720 " record
Length: 19
GC Content:47 %
Starting position: 191
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Genejammer
Incubation Time (Hours):14 Days

Offtargets for "uguguguacugcaagcaac" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16681752
Article:Extended effects of human papillomavirus 16 E6-specific short hairpin RNA on cervical carcinoma cells.
Authors:Bai L, Wei L, Wang J, Li X, He P.
Journal:Int J Gynecol Cancer. 2006 Mar-Apr;16(2):718-29.
Entrez:16681752

siRNA sequence "gcauggagauacaccuaca" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcauggagauacaccuaca" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1766 " record
Length: 19
GC Content:47 %
Starting position: 564
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine
Incubation Time (Hours):72

Offtargets for "gcauggagauacaccuaca" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18060502
Article:RNA interference against HPV16 E7 oncogene leads to viral E6 and E7 suppression in cervical cancer cells and apoptosis via upregulation of Rb and p53.
Authors:Sima N, Wang W, Kong D, Deng D, Xu Q, Zhou J, Xu G, Meng L, Lu Y, Wang S, Ma D.
Journal:Apoptosis. 2008 Feb;13(2):273-81.
Entrez:18060502

siRNA sequence "ggaagaaaacgaugaaaua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ggaagaaaacgaugaaaua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1731 " record
Length: 19
GC Content:32 %
Starting position: 694
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):96

Offtargets for "ggaagaaaacgaugaaaua" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:15908516
Article:Chemotherapy compounds in cervical cancer cells primed by reconstitution of p53 function after short interfering RNA-mediated degradation of human papillomavirus 18 E6 mRNA: opposite effect of siRNA in combination with different drugs.
Authors:Koivusalo R, Krausz E, Helenius H, Hietanen S.
Journal:Mol Pharmacol. 2005 Aug;68(2):372-82. Epub 2005 May 20.
Entrez:15908516

siRNA sequence "aggaggaugaaauagaugg" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "aggaggaugaaauagaugg" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1767 " record
Length: 19
GC Content:42 %
Starting position: 662
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72

Offtargets for "aggaggaugaaauagaugg" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:15665592
Article:Gel-based application of siRNA to human epithelial cancer cells induces RNAi-dependent apoptosis.
Authors:Jiang M, Rubbi CP, Milner J.
Journal:Oligonucleotides. 2004 Winter;14(4):239-48.
Entrez:15665592

siRNA sequence "caguuacugcgacgugaggu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "caguuacugcgacgugaggu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1721 " record
Length: 20
GC Content:55 %
Starting position: 209
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Genejammer
Incubation Time (Hours):14 Days

Offtargets for "caguuacugcgacgugaggu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16681752
Article:Extended effects of human papillomavirus 16 E6-specific short hairpin RNA on cervical carcinoma cells.
Authors:Bai L, Wei L, Wang J, Li X, He P.
Journal:Int J Gynecol Cancer. 2006 Mar-Apr;16(2):718-29.
Entrez:16681752

siRNA sequence "uguguacugcaagcaacag" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "uguguacugcaagcaacag" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1704 " record
Length: 19
GC Content:47 %
Starting position: 193
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: TransMessenger
Incubation Time (Hours):48

Offtargets for "uguguacugcaagcaacag" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16681755
Article:Inhibition of HPV 16 E6 oncogene expression by RNA interference in vitro and in vivo.
Authors:Niu XY, Peng ZL, Duan WQ, Wang H, Wang P.
Journal:Int J Gynecol Cancer. 2006 Mar-Apr;16(2):743-51.
Entrez:16681755

siRNA sequence "ucucuacuguuaugagcaauua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ucucuacuguuaugagcaauua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1740 " record
Length: 22
GC Content:32 %
Starting position: 624
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24

Offtargets for "ucucuacuguuaugagcaauua" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450

siRNA sequence "gcaacaguuacugcgacgu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcaacaguuacugcgacgu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1724 " record
Length: 19
GC Content:53 %
Starting position: 205
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24

Offtargets for "gcaacaguuacugcgacgu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16120770
Article:RNA interference against human papillomavirus oncogenes in cervical cancer cells results in increased sensitivity to cisplatin.
Authors:Putral LN, Bywater MJ, Gu W, Saunders NA, Gabrielli BG, Leggatt GR, McMillan NA.
Journal:Mol Pharmacol. 2005 Nov;68(5):1311-9. Epub 2005 Aug 24.
Entrez:16120770

siRNA sequence "ggcaacauugcaagacauu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ggcaacauugcaagacauu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1730 " record
Length: 19
GC Content:42 %
Starting position: 604
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48

Offtargets for "ggcaacauugcaagacauu" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:15908516
Article:Chemotherapy compounds in cervical cancer cells primed by reconstitution of p53 function after short interfering RNA-mediated degradation of human papillomavirus 18 E6 mRNA: opposite effect of siRNA in combination with different drugs.
Authors:Koivusalo R, Krausz E, Helenius H, Hietanen S.
Journal:Mol Pharmacol. 2005 Aug;68(2):372-82. Epub 2005 May 20.
Entrez:15908516

siRNA sequence "cacguagagaaacccagcu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cacguagagaaacccagcu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1725 " record
Length: 19
GC Content:53 %
Starting position: 537
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24

Offtargets for "cacguagagaaacccagcu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16120770
Article:RNA interference against human papillomavirus oncogenes in cervical cancer cells results in increased sensitivity to cisplatin.
Authors:Putral LN, Bywater MJ, Gu W, Saunders NA, Gabrielli BG, Leggatt GR, McMillan NA.
Journal:Mol Pharmacol. 2005 Nov;68(5):1311-9. Epub 2005 Aug 24.
Entrez:16120770

siRNA sequence "gcacacacguagacauucg" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcacacacguagacauucg" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1768 " record
Length: 19
GC Content:53 %
Starting position: 773
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48

Offtargets for "gcacacacguagacauucg" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16369495
Article:Short-term induction and long-term suppression of HPV16 oncogene silencing by RNA interference in cervical cancer cells.
Authors:Tang S, Tao M, McCoy JP Jr, Zheng ZM.
Journal:Oncogene. 2006 Mar 30;25(14):2094-104.
Entrez:16369495

siRNA sequence "cuucgguugugcguacaaagc" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cuucgguugugcguacaaagc" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1760 " record
Length: 21
GC Content:52 %
Starting position: 754
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "cuucgguugugcguacaaagc" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144

siRNA sequence "cuaacuaacacuggguuau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cuaacuaacacuggguuau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1702 " record
Length: 19
GC Content:37 %
Starting position: 381
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48

Offtargets for "cuaacuaacacuggguuau" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:12955072
Article:siRNA targeting of the viral E6 oncogene efficiently kills human papillomavirus-positive cancer cells.
Authors:Butz K, Ristriani T, Hengstermann A, Denk C, Scheffner M, Hoppe-Seyler F.
Journal:Oncogene. 2003 Sep 4;22(38):5938-45.
Entrez:12955072

siRNA sequence "auagugaccuguugcugug" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "auagugaccuguugcugug" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1690 " record
Length: 19
GC Content:47 %
Starting position: 689
Strain of Virus: HPV6b
GenBank Acc: X00203
Transfection Reagent: Lipofectamine 2000

Offtargets for "auagugaccuguugcugug" siRNA in Human Genome sequences
See X00203 at Genbank
Pubmed:19887612
Article:Epigenetic silencing of interferon-kappa in human papillomavirus type 16-positive cells.
Authors:Rincon-Orozco B, Halec G, Rosenberger S, Muschik D, Nindl I, Bachmann A, Ritter TM, Dondog B, Ly R, Bosch FX, Zawatzky R, Rösl F.
Journal:Cancer Res. 2009 Nov 15;69(22):8718-25. Epub 2009 Nov 3.
Entrez:19887612

siRNA sequence "acaagacgcacaaccuuua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "acaagacgcacaaccuuua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1689 " record
Length: 19
GC Content:42 %
Starting position: 655
Strain of Virus: HPV11
GenBank Acc: FN907963
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "acaagacgcacaaccuuua" siRNA in Human Genome sequences
See FN907963 at Genbank
Pubmed:19887612
Article:Epigenetic silencing of interferon-kappa in human papillomavirus type 16-positive cells.
Authors:Rincon-Orozco B, Halec G, Rosenberger S, Muschik D, Nindl I, Bachmann A, Ritter TM, Dondog B, Ly R, Bosch FX, Zawatzky R, Rösl F.
Journal:Cancer Res. 2009 Nov 15;69(22):8718-25. Epub 2009 Nov 3.
Entrez:19887612

siRNA sequence "gcccauuacaauauuguaacc" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcccauuacaauauuguaacc" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1759 " record
Length: 21
GC Content:38 %
Starting position: 709
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gcccauuacaauauuguaacc" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144

siRNA sequence "gaccggucgauguaugucuug" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gaccggucgauguaugucuug" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1756 " record
Length: 21
GC Content:52 %
Starting position: 499
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gaccggucgauguaugucuug" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144

siRNA sequence "caccuacauugcaugaauaua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "caccuacauugcaugaauaua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1761 " record
Length: 21
GC Content:33 %
Starting position: 575
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "caccuacauugcaugaauaua" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144

siRNA sequence "gagguauaugacuuugcuu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gagguauaugacuuugcuu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1698 " record
Length: 19
GC Content:37 %
Starting position: 224
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48

Offtargets for "gagguauaugacuuugcuu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:12203116
Article:Selective silencing of viral gene expression in HPV-positive human cervical carcinoma cells treated with siRNA, a primer of RNA interference.
Authors:Jiang M, Milner J.
Journal:Oncogene. 2002 Sep 5;21(39):6041-8.
Entrez:12203116

siRNA sequence "gaauguguguacugcaagc" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gaauguguguacugcaagc" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1697 " record
Length: 19
GC Content:47 %
Starting position: 188
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24

Offtargets for "gaauguguguacugcaagc" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:14599809
Article:In vitro and in vivo growth suppression of human papillomavirus 16-positive cervical cancer cells by E6 siRNA.
Authors:Yoshinouchi M, Yamada T, Kizaki M, Fen J, Koseki T, Ikeda Y, Nishihara T, Yamato K.
Journal:Mol Ther. 2003 Nov;8(5):762-8.
Entrez:14599809

siRNA sequence "gcaaacaacuauacaugaua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcaaacaacuauacaugaua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1736 " record
Length: 20
GC Content:30 %
Starting position: 160
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24

Offtargets for "gcaaacaacuauacaugaua" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450

siRNA sequence "cucuacuguuaugagc" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cucuacuguuaugagc" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1739 " record
Length: 16
GC Content:44 %
Starting position: 625
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24

Offtargets for "cucuacuguuaugagc" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1701	ccuguguauauugcaagac	Human Papillomavirus [HPV]	E6	HeLa/SW756	mRNA	97	16138119	Blast SL	refseqs
virsi1700	gagguauuugaauuugcau	Human Papillomavirus [HPV]	E6	HeLa/SW756	mRNA	96	16138119	Blast SL	refseqs
virsi1726	agguauuugaauuugcau	Human Papillomavirus [HPV]	E6	CaSki	Protein	90	16120770	Blast SL	refseqs
virsi1720	uguguguacugcaagcaac	Human Papillomavirus [HPV]	E6	SiHa	mRNA	90	16681752	Blast SL	refseqs
virsi1766	gcauggagauacaccuaca	Human Papillomavirus [HPV]	E7	CaSki	Protein	88	18060502	Blast SL	refseqs
virsi1731	ggaagaaaacgaugaaaua	Human Papillomavirus [HPV]	E7	HeLa	mRNA	85	15908516	Blast SL	refseqs
virsi1767	aggaggaugaaauagaugg	Human Papillomavirus [HPV]	E7	SiHa	mRNA	85	15665592	Blast SL	refseqs
virsi1721	caguuacugcgacgugaggu	Human Papillomavirus [HPV]	E6	SiHa	mRNA	85	16681752	Blast SL	refseqs
virsi1704	uguguacugcaagcaacag	Human Papillomavirus [HPV]	E6	CaSki	mRNA	83	16681755	Blast SL	refseqs
virsi1740	ucucuacuguuaugagcaauua	Human Papillomavirus [HPV]	E7	HeLa	mRNA	82	20885450	Blast SL	refseqs
virsi1724	gcaacaguuacugcgacgu	Human Papillomavirus [HPV]	E6	CaSki	Protein	81	16120770	Blast SL	refseqs
virsi1730	ggcaacauugcaagacauu	Human Papillomavirus [HPV]	E7	HeLa	mRNA	80	15908516	Blast SL	refseqs
virsi1725	cacguagagaaacccagcu	Human Papillomavirus [HPV]	E6	CaSki	Protein	79	16120770	Blast SL	refseqs
virsi1768	gcacacacguagacauucg	Human Papillomavirus [HPV]	E7	CaSki	Protein	77	16369495	Blast SL	refseqs
virsi1760	cuucgguugugcguacaaagc	Human Papillomavirus [HPV]	E7	SiHa	mRNA	76	18157144	Blast SL	refseqs
virsi1702	cuaacuaacacuggguuau	Human Papillomavirus [HPV]	E6	HeLa	mRNA	75	12955072	Blast SL	refseqs
virsi1690	auagugaccuguugcugug	Human Papillomavirus [HPV]	E7	B16-BL6	mRNA	75	19887612	Blast SL	refseqs
virsi1689	acaagacgcacaaccuuua	Human Papillomavirus [HPV]	E7	B16-BL6	mRNA	74	19887612	Blast SL	refseqs
virsi1759	gcccauuacaauauuguaacc	Human Papillomavirus [HPV]	E7	SiHa	mRNA	74	18157144	Blast SL	refseqs
virsi1756	gaccggucgauguaugucuug	Human Papillomavirus [HPV]	E6	SiHa	mRNA	73	18157144	Blast SL	refseqs
virsi1761	caccuacauugcaugaauaua	Human Papillomavirus [HPV]	E7	SiHa	mRNA	71	18157144	Blast SL	refseqs
virsi1698	gagguauaugacuuugcuu	Human Papillomavirus [HPV]	E6	CaSki	mRNA	70	12203116	Blast SL	refseqs
virsi1697	gaauguguguacugcaagc	Human Papillomavirus [HPV]	E6	COS-1	mRNA	70	14599809	Blast SL	refseqs
virsi1736	gcaaacaacuauacaugaua	Human Papillomavirus [HPV]	E6	HeLa	mRNA	69	20885450	Blast SL	refseqs
virsi1739	cucuacuguuaugagc	Human Papillomavirus [HPV]	E7	HeLa	mRNA	69	20885450	Blast SL	refseqs



« previous1234next »

: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm