VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for Papillomaviridae are 87
Results from 50 - 75

« previous1234next »
siRNA sequence "ccggacagagcccauuacaau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ccggacagagcccauuacaau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1758 " record
Length: 21
GC Content:52 %
Starting position: 700
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "ccggacagagcccauuacaau" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144

siRNA sequence "cugcaaacaacuauacau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cugcaaacaacuauacau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1737 " record
Length: 18
GC Content:33 %
Starting position: 158
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24

Offtargets for "cugcaaacaacuauacau" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450

siRNA sequence "gcaauuaaaugacagcuca" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcaauuaaaugacagcuca" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1748 " record
Length: 19
GC Content:37 %
Starting position: 639
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: siQUEST
Incubation Time (Hours):48

Offtargets for "gcaauuaaaugacagcuca" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18755502
Article:Gene silencing with siRNA targeting E6/E7 as a therapeutic intervention in a mouse model of cervical cancer.
Authors:Jonson AL, Rogers LM, Ramakrishnan S, Downs LS Jr.
Journal:Gynecol Oncol. 2008 Nov;111(2):356-64. Epub 2008 Aug 27.
Entrez:18755502

siRNA sequence "ccaacacggcgacccua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ccaacacggcgacccua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1741 " record
Length: 17
GC Content:65 %
Starting position: 123
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24

Offtargets for "ccaacacggcgacccua" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450

siRNA sequence "ccguugugugauuuguuaa" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ccguugugugauuuguuaa" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1764 " record
Length: 19
GC Content:37 %
Starting position: 386
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Hiperfect
Incubation Time (Hours):48

Offtargets for "ccguugugugauuuguuaa" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:17575104
Article:Suppression of cervical carcinoma cell growth by intracytoplasmic codelivery of anti-oncoprotein E6 antibody and small interfering RNA.
Authors:Courtête J, Sibler AP, Zeder-Lutz G, Dalkara D, Oulad-Abdelghani M, Zuber G, Weiss E.
Journal:Mol Cancer Ther. 2007 Jun;6(6):1728-35.
Entrez:17575104

siRNA sequence "cuaacuaacacuggguuau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cuaacuaacacuggguuau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1765 " record
Length: 19
GC Content:37 %
Starting position: 381
Strain of Virus: HPV16
GenBank Acc: NC_001357
Transfection Reagent: Hiperfect
Incubation Time (Hours):48

Offtargets for "cuaacuaacacuggguuau" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:17575104
Article:Suppression of cervical carcinoma cell growth by intracytoplasmic codelivery of anti-oncoprotein E6 antibody and small interfering RNA.
Authors:Courtête J, Sibler AP, Zeder-Lutz G, Dalkara D, Oulad-Abdelghani M, Zuber G, Weiss E.
Journal:Mol Cancer Ther. 2007 Jun;6(6):1728-35.
Entrez:17575104

siRNA sequence "gacagagcccauuacaaua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gacagagcccauuacaaua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1750 " record
Length: 19
GC Content:42 %
Starting position: 703
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: siQUEST
Incubation Time (Hours):48

Offtargets for "gacagagcccauuacaaua" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18755502
Article:Gene silencing with siRNA targeting E6/E7 as a therapeutic intervention in a mouse model of cervical cancer.
Authors:Jonson AL, Rogers LM, Ramakrishnan S, Downs LS Jr.
Journal:Gynecol Oncol. 2008 Nov;111(2):356-64. Epub 2008 Aug 27.
Entrez:18755502

siRNA sequence "cuaacacuggguuauacaa" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cuaacacuggguuauacaa" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1729 " record
Length: 19
GC Content:37 %
Starting position: 385
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):50

Offtargets for "cuaacacuggguuauacaa" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:15908516
Article:Chemotherapy compounds in cervical cancer cells primed by reconstitution of p53 function after short interfering RNA-mediated degradation of human papillomavirus 18 E6 mRNA: opposite effect of siRNA in combination with different drugs.
Authors:Koivusalo R, Krausz E, Helenius H, Hietanen S.
Journal:Mol Pharmacol. 2005 Aug;68(2):372-82. Epub 2005 May 20.
Entrez:15908516

siRNA sequence "acccuacaagcuaccugau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "acccuacaagcuaccugau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1719 " record
Length: 19
GC Content:47 %
Starting position: 134
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Surefector
Incubation Time (Hours):36

Offtargets for "acccuacaagcuaccugau" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:16865269
Article:Intratumor injection of small interfering RNA-targeting human papillomavirus 18 E6 and E7 successfully inhibits the growth of cervical cancer.
Authors:Fujii T, Saito M, Iwasaki E, Ochiya T, Takei Y, Hayashi S, Ono A, Hirao N, Nakamura M, Kubushiro K, Tsukazaki K, Aoki D.
Journal:Int J Oncol. 2006 Sep;29(3):541-8.
Entrez:16865269

siRNA sequence "ggucgauguaugucuuguugc" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ggucgauguaugucuuguugc" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1757 " record
Length: 21
GC Content:48 %
Starting position: 503
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "ggucgauguaugucuuguugc" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144

siRNA sequence "cgcgguucauaaagcuaaa" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cgcgguucauaaagcuaaa" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1691 " record
Length: 19
GC Content:42 %
Starting position: 472
Strain of Virus: HPV6b
GenBank Acc: X00203
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "cgcgguucauaaagcuaaa" siRNA in Human Genome sequences
See X00203 at Genbank
Pubmed:19887612
Article:Epigenetic silencing of interferon-kappa in human papillomavirus type 16-positive cells.
Authors:Rincon-Orozco B, Halec G, Rosenberger S, Muschik D, Nindl I, Bachmann A, Ritter TM, Dondog B, Ly R, Bosch FX, Zawatzky R, Rösl F.
Journal:Cancer Res. 2009 Nov 15;69(22):8718-25. Epub 2009 Nov 3.
Entrez:19887612

siRNA sequence "agacaucuuagacgugcua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "agacaucuuagacgugcua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1692 " record
Length: 19
GC Content:42 %
Starting position: 386
Strain of Virus: HPV6b
GenBank Acc: X00203
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "agacaucuuagacgugcua" siRNA in Human Genome sequences
See X00203 at Genbank
Pubmed:19887612
Article:Epigenetic silencing of interferon-kappa in human papillomavirus type 16-positive cells.
Authors:Rincon-Orozco B, Halec G, Rosenberger S, Muschik D, Nindl I, Bachmann A, Ritter TM, Dondog B, Ly R, Bosch FX, Zawatzky R, Rösl F.
Journal:Cancer Res. 2009 Nov 15;69(22):8718-25. Epub 2009 Nov 3.
Entrez:19887612

siRNA sequence "gaccacagcagagauuuau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gaccacagcagagauuuau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1693 " record
Length: 19
GC Content:42 %
Starting position: 215
Strain of Virus: HPV6b
GenBank Acc: X00203
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gaccacagcagagauuuau" siRNA in Human Genome sequences
See X00203 at Genbank
Pubmed:19887612
Article:Epigenetic silencing of interferon-kappa in human papillomavirus type 16-positive cells.
Authors:Rincon-Orozco B, Halec G, Rosenberger S, Muschik D, Nindl I, Bachmann A, Ritter TM, Dondog B, Ly R, Bosch FX, Zawatzky R, Rösl F.
Journal:Cancer Res. 2009 Nov 15;69(22):8718-25. Epub 2009 Nov 3.
Entrez:19887612

siRNA sequence "aggaggaugaaauagaugg" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "aggaggaugaaauagaugg" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1699 " record
Length: 19
GC Content:42 %
Starting position: 662
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48

Offtargets for "aggaggaugaaauagaugg" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:12203116
Article:Selective silencing of viral gene expression in HPV-positive human cervical carcinoma cells treated with siRNA, a primer of RNA interference.
Authors:Jiang M, Milner J.
Journal:Oncogene. 2002 Sep 5;21(39):6041-8.
Entrez:12203116

siRNA sequence "acaagacgcacaaccuuua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "acaagacgcacaaccuuua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1694 " record
Length: 19
GC Content:42 %
Starting position: 655
Strain of Virus: HPV11
GenBank Acc: FN907963
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "acaagacgcacaaccuuua" siRNA in Human Genome sequences
See FN907963 at Genbank
Pubmed:19887612
Article:Epigenetic silencing of interferon-kappa in human papillomavirus type 16-positive cells.
Authors:Rincon-Orozco B, Halec G, Rosenberger S, Muschik D, Nindl I, Bachmann A, Ritter TM, Dondog B, Ly R, Bosch FX, Zawatzky R, Rösl F.
Journal:Cancer Res. 2009 Nov 15;69(22):8718-25. Epub 2009 Nov 3.
Entrez:19887612

siRNA sequence "acauugcuaugagcaauua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "acauugcuaugagcaauua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1695 " record
Length: 19
GC Content:32 %
Starting position: 598
Strain of Virus: HPV11
GenBank Acc: FN907963
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "acauugcuaugagcaauua" siRNA in Human Genome sequences
See FN907963 at Genbank
Pubmed:19887612
Article:Epigenetic silencing of interferon-kappa in human papillomavirus type 16-positive cells.
Authors:Rincon-Orozco B, Halec G, Rosenberger S, Muschik D, Nindl I, Bachmann A, Ritter TM, Dondog B, Ly R, Bosch FX, Zawatzky R, Rösl F.
Journal:Cancer Res. 2009 Nov 15;69(22):8718-25. Epub 2009 Nov 3.
Entrez:19887612

siRNA sequence "cggagacaucagacaacua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cggagacaucagacaacua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1696 " record
Length: 19
GC Content:47 %
Starting position: 748
Strain of Virus: HPV11
GenBank Acc: FN907963
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "cggagacaucagacaacua" siRNA in Human Genome sequences
See FN907963 at Genbank
Pubmed:19887612
Article:Epigenetic silencing of interferon-kappa in human papillomavirus type 16-positive cells.
Authors:Rincon-Orozco B, Halec G, Rosenberger S, Muschik D, Nindl I, Bachmann A, Ritter TM, Dondog B, Ly R, Bosch FX, Zawatzky R, Rösl F.
Journal:Cancer Res. 2009 Nov 15;69(22):8718-25. Epub 2009 Nov 3.
Entrez:19887612

siRNA sequence "gguggaccggucgauguaugu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gguggaccggucgauguaugu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1755 " record
Length: 21
GC Content:57 %
Starting position: 495
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gguggaccggucgauguaugu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144

siRNA sequence "gggauuuaugcauaguauaua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gggauuuaugcauaguauaua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1754 " record
Length: 21
GC Content:29 %
Starting position: 246
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gggauuuaugcauaguauaua" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144

siRNA sequence "accguugugugauuuguua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "accguugugugauuuguua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1722 " record
Length: 19
GC Content:37 %
Starting position: 385
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Genejammer
Incubation Time (Hours):14 Days

Offtargets for "accguugugugauuuguua" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16681752
Article:Extended effects of human papillomavirus 16 E6-specific short hairpin RNA on cervical carcinoma cells.
Authors:Bai L, Wei L, Wang J, Li X, He P.
Journal:Int J Gynecol Cancer. 2006 Mar-Apr;16(2):718-29.
Entrez:16681752

siRNA sequence "gcacagagcugcaaacaac" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcacagagcugcaaacaac" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1744 " record
Length: 19
GC Content:53 %
Starting position: 150
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: siQUEST
Incubation Time (Hours):48

Offtargets for "gcacagagcugcaaacaac" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18755502
Article:Gene silencing with siRNA targeting E6/E7 as a therapeutic intervention in a mouse model of cervical cancer.
Authors:Jonson AL, Rogers LM, Ramakrishnan S, Downs LS Jr.
Journal:Gynecol Oncol. 2008 Nov;111(2):356-64. Epub 2008 Aug 27.
Entrez:18755502

siRNA sequence "cugaacacuucacugcaag" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cugaacacuucacugcaag" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1727 " record
Length: 19
GC Content:47 %
Starting position: 165
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):96

Offtargets for "cugaacacuucacugcaag" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:15908516
Article:Chemotherapy compounds in cervical cancer cells primed by reconstitution of p53 function after short interfering RNA-mediated degradation of human papillomavirus 18 E6 mRNA: opposite effect of siRNA in combination with different drugs.
Authors:Koivusalo R, Krausz E, Helenius H, Hietanen S.
Journal:Mol Pharmacol. 2005 Aug;68(2):372-82. Epub 2005 May 20.
Entrez:15908516

siRNA sequence "gcccauuacaauauuguaac" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcccauuacaauauuguaac" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1714 " record
Length: 20
GC Content:35 %
Starting position: 709
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24

Offtargets for "gcccauuacaauauuguaac" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:19174559
Article:Inhibition of cervical cancer cell growth by human papillomavirus virus-like particles packaged with human papillomavirus oncoprotein short hairpin RNAs.
Authors:Bousarghin L, Touze A, Gaud G, Iochmann S, Alvarez E, Reverdiau P, Gaitan J, Jourdan ML, Sizaret PY, Coursaget PL.
Journal:Mol Cancer Ther. 2009 Feb;8(2):357-65. Epub 2009 Jan 27.
Entrez:19174559

siRNA sequence "guaaccgaaaucgguugaacc" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "guaaccgaaaucgguugaacc" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1769 " record
Length: 21
GC Content:48 %
Starting position: 32
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Codebreaker
Incubation Time (Hours):48

Offtargets for "guaaccgaaaucgguugaacc" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:19826423
Article:Gene silencing of HPV16 E6/E7 induced by promoter-targeting siRNA in SiHa cells.
Authors:Hong D, Lu W, Ye F, Hu Y, Xie X.
Journal:Br J Cancer. 2009 Nov 17;101(10):1798-804. Epub 2009 Oct 13.
Entrez:19826423

siRNA sequence "cgggauuuaugcauaguauau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cgggauuuaugcauaguauau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1753 " record
Length: 21
GC Content:33 %
Starting position: 245
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "cgggauuuaugcauaguauau" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1758	ccggacagagcccauuacaau	Human Papillomavirus [HPV]	E7	SiHa	mRNA	68	18157144	Blast SL	refseqs
virsi1737	cugcaaacaacuauacau	Human Papillomavirus [HPV]	E6	HeLa	mRNA	68	20885450	Blast SL	refseqs
virsi1748	gcaauuaaaugacagcuca	Human Papillomavirus [HPV]	E7	CaSki	mRNA	67	18755502	Blast SL	refseqs
virsi1741	ccaacacggcgacccua	Human Papillomavirus [HPV]	E6	HeLa	mRNA	63	20885450	Blast SL	refseqs
virsi1764	ccguugugugauuuguuaa	Human Papillomavirus [HPV]	E6	CaSki	mRNA	60	17575104	Blast SL	refseqs
virsi1765	cuaacuaacacuggguuau	Human Papillomavirus [HPV]	E6	CaSki	mRNA	60	17575104	Blast SL	refseqs
virsi1750	gacagagcccauuacaaua	Human Papillomavirus [HPV]	E7	CaSki	mRNA	60	18755502	Blast SL	refseqs
virsi1729	cuaacacuggguuauacaa	Human Papillomavirus [HPV]	E6	HeLa	mRNA	60	15908516	Blast SL	refseqs
virsi1719	acccuacaagcuaccugau	Human Papillomavirus [HPV]	E6 / E7	SKG-II	mRNA	60	16865269	Blast SL	refseqs
virsi1757	ggucgauguaugucuuguugc	Human Papillomavirus [HPV]	E6	SiHa	mRNA	58	18157144	Blast SL	refseqs
virsi1691	cgcgguucauaaagcuaaa	Human Papillomavirus [HPV]	E7	B16-BL6	mRNA	58	19887612	Blast SL	refseqs
virsi1692	agacaucuuagacgugcua	Human Papillomavirus [HPV]	E7	B16-BL6	mRNA	58	19887612	Blast SL	refseqs
virsi1693	gaccacagcagagauuuau	Human Papillomavirus [HPV]	E7	B16-BL6	mRNA	58	19887612	Blast SL	refseqs
virsi1699	aggaggaugaaauagaugg	Human Papillomavirus [HPV]	E7	CaSki	mRNA	55	12203116	Blast SL	refseqs
virsi1694	acaagacgcacaaccuuua	Human Papillomavirus [HPV]	E7	B16-BL6	mRNA	55	19887612	Blast SL	refseqs
virsi1695	acauugcuaugagcaauua	Human Papillomavirus [HPV]	E7	B16-BL6	mRNA	55	19887612	Blast SL	refseqs
virsi1696	cggagacaucagacaacua	Human Papillomavirus [HPV]	E7	B16-BL6	mRNA	55	19887612	Blast SL	refseqs
virsi1755	gguggaccggucgauguaugu	Human Papillomavirus [HPV]	E6	SiHa	mRNA	54	18157144	Blast SL	refseqs
virsi1754	gggauuuaugcauaguauaua	Human Papillomavirus [HPV]	E6	SiHa	mRNA	53	18157144	Blast SL	refseqs
virsi1722	accguugugugauuuguua	Human Papillomavirus [HPV]	E6	SiHa	mRNA	53	16681752	Blast SL	refseqs
virsi1744	gcacagagcugcaaacaac	Human Papillomavirus [HPV]	E7	CaSki	mRNA	50	18755502	Blast SL	refseqs
virsi1727	cugaacacuucacugcaag	Human Papillomavirus [HPV]	E6	HeLa	mRNA	50	15908516	Blast SL	refseqs
virsi1714	gcccauuacaauauuguaac	Human Papillomavirus [HPV]	E7	CaSki	RNA	50	19174559	Blast SL	refseqs
virsi1769	guaaccgaaaucgguugaacc	Human Papillomavirus [HPV]	P97 of E6/E7	SiHa	mRNA	50	19826423	Blast SL	refseqs
virsi1753	cgggauuuaugcauaguauau	Human Papillomavirus [HPV]	E6	SiHa	mRNA	37	18157144	Blast SL	refseqs



« previous1234next »

: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm