VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for Papillomaviridae are 87
Results from 75 - 100

« previous1234next »
siRNA sequence "cuuugcuuuucgggauuuaug" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cuuugcuuuucgggauuuaug" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1752 " record
Length: 21
GC Content:38 %
Starting position: 235
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "cuuugcuuuucgggauuuaug" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144

siRNA sequence "gaaauagaugguccagc" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gaaauagaugguccagc" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1738 " record
Length: 17
GC Content:47 %
Starting position: 670
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24

Offtargets for "gaaauagaugguccagc" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450

siRNA sequence "gcaaagacaucuggacaaa" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcaaagacaucuggacaaa" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1723 " record
Length: 19
GC Content:42 %
Starting position: 448
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Genejammer
Incubation Time (Hours):14 Days

Offtargets for "gcaaagacaucuggacaaa" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16681752
Article:Extended effects of human papillomavirus 16 E6-specific short hairpin RNA on cervical carcinoma cells.
Authors:Bai L, Wei L, Wang J, Li X, He P.
Journal:Int J Gynecol Cancer. 2006 Mar-Apr;16(2):718-29.
Entrez:16681752

siRNA sequence "guacaaagcacacacguag" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "guacaaagcacacacguag" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1749 " record
Length: 19
GC Content:47 %
Starting position: 766
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: siQUEST
Incubation Time (Hours):48

Offtargets for "guacaaagcacacacguag" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18755502
Article:Gene silencing with siRNA targeting E6/E7 as a therapeutic intervention in a mouse model of cervical cancer.
Authors:Jonson AL, Rogers LM, Ramakrishnan S, Downs LS Jr.
Journal:Gynecol Oncol. 2008 Nov;111(2):356-64. Epub 2008 Aug 27.
Entrez:18755502

siRNA sequence "uuaugcauaguauauagag" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "uuaugcauaguauauagag" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1735 " record
Length: 19
GC Content:26 %
Starting position: 251
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24

Offtargets for "uuaugcauaguauauagag" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450

siRNA sequence "aacgaugaaauagauggag" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "aacgaugaaauagauggag" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1716 " record
Length: 19
GC Content:37 %
Starting position: 701
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72

Offtargets for "aacgaugaaauagauggag" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:17589817
Article:Identification of cellular targets for the human papillomavirus E6 and E7 oncogenes by RNA interference and transcriptome analyses.
Authors:Kuner R, Vogt M, Sultmann H, Buness A, Dymalla S, Bulkescher J, Fellmann M, Butz K, Poustka A, Hoppe-Seyler F.
Journal:J Mol Med (Berl). 2007 Nov;85(11):1253-62. Epub 2007 Jun 23.
Entrez:17589817

siRNA sequence "ggagcgacccagaaaguua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ggagcgacccagaaaguua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1745 " record
Length: 19
GC Content:53 %
Starting position: 121
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: siQUEST
Incubation Time (Hours):48

Offtargets for "ggagcgacccagaaaguua" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18755502
Article:Gene silencing with siRNA targeting E6/E7 as a therapeutic intervention in a mouse model of cervical cancer.
Authors:Jonson AL, Rogers LM, Ramakrishnan S, Downs LS Jr.
Journal:Gynecol Oncol. 2008 Nov;111(2):356-64. Epub 2008 Aug 27.
Entrez:18755502

siRNA sequence "gacgugagguauaugacuu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gacgugagguauaugacuu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1746 " record
Length: 19
GC Content:42 %
Starting position: 219
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: siQUEST
Incubation Time (Hours):48

Offtargets for "gacgugagguauaugacuu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18755502
Article:Gene silencing with siRNA targeting E6/E7 as a therapeutic intervention in a mouse model of cervical cancer.
Authors:Jonson AL, Rogers LM, Ramakrishnan S, Downs LS Jr.
Journal:Gynecol Oncol. 2008 Nov;111(2):356-64. Epub 2008 Aug 27.
Entrez:18755502

siRNA sequence "gggaauccauaugcuguau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gggaauccauaugcuguau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1747 " record
Length: 19
GC Content:42 %
Starting position: 272
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: siQUEST
Incubation Time (Hours):48

Offtargets for "gggaauccauaugcuguau" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18755502
Article:Gene silencing with siRNA targeting E6/E7 as a therapeutic intervention in a mouse model of cervical cancer.
Authors:Jonson AL, Rogers LM, Ramakrishnan S, Downs LS Jr.
Journal:Gynecol Oncol. 2008 Nov;111(2):356-64. Epub 2008 Aug 27.
Entrez:18755502

siRNA sequence "caccuacauugcaugaaua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "caccuacauugcaugaaua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1751 " record
Length: 19
GC Content:37 %
Starting position: 575
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: siQUEST
Incubation Time (Hours):48

Offtargets for "caccuacauugcaugaaua" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18755502
Article:Gene silencing with siRNA targeting E6/E7 as a therapeutic intervention in a mouse model of cervical cancer.
Authors:Jonson AL, Rogers LM, Ramakrishnan S, Downs LS Jr.
Journal:Gynecol Oncol. 2008 Nov;111(2):356-64. Epub 2008 Aug 27.
Entrez:18755502

siRNA sequence "uguguguacugcaagcaac" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "uguguguacugcaagcaac" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1732 " record
Length: 19
GC Content:47 %
Starting position: 191
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):96

Offtargets for "uguguguacugcaagcaac" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:15908516
Article:Chemotherapy compounds in cervical cancer cells primed by reconstitution of p53 function after short interfering RNA-mediated degradation of human papillomavirus 18 E6 mRNA: opposite effect of siRNA in combination with different drugs.
Authors:Koivusalo R, Krausz E, Helenius H, Hietanen S.
Journal:Mol Pharmacol. 2005 Aug;68(2):372-82. Epub 2005 May 20.
Entrez:15908516

siRNA sequence "cagaaaaacuuagacaccu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cagaaaaacuuagacaccu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1734 " record
Length: 19
GC Content:37 %
Starting position: 448
Strain of Virus: HPV18
GenBank Acc: NC_001357
Incubation Time (Hours):48

Offtargets for "cagaaaaacuuagacaccu" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:16810314
Article:Inhibition of cervical cancer cell growth in vitro and in vivo with lentiviral-vector delivered short hairpin RNA targeting human papillomavirus E6 and E7 oncogenes.
Authors:Gu W, Putral L, Hengst K, Minto K, Saunders NA, Leggatt G, McMillan NA.
Journal:Cancer Gene Ther. 2006 Nov;13(11):1023-32. Epub 2006 Jun 30.
Entrez:16810314


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1752	cuuugcuuuucgggauuuaug	Human Papillomavirus [HPV]	E6	SiHa	mRNA	36	18157144	Blast SL	refseqs
virsi1738	gaaauagaugguccagc	Human Papillomavirus [HPV]	E7	HeLa	mRNA	30	20885450	Blast SL	refseqs
virsi1723	gcaaagacaucuggacaaa	Human Papillomavirus [HPV]	E6	SiHa	mRNA	30	16681752	Blast SL	refseqs
virsi1749	guacaaagcacacacguag	Human Papillomavirus [HPV]	E7	CaSki	mRNA	15	18755502	Blast SL	refseqs
virsi1735	uuaugcauaguauauagag	Human Papillomavirus [HPV]	E6	HeLa	mRNA	11	20885450	Blast SL	refseqs
virsi1716	aacgaugaaauagauggag	Human Papillomavirus [HPV]	E7	HeLa	Protein	10	17589817	Blast SL	refseqs
virsi1745	ggagcgacccagaaaguua	Human Papillomavirus [HPV]	E7	CaSki	mRNA	0	18755502	Blast SL	refseqs
virsi1746	gacgugagguauaugacuu	Human Papillomavirus [HPV]	E7	CaSki	mRNA	0	18755502	Blast SL	refseqs
virsi1747	gggaauccauaugcuguau	Human Papillomavirus [HPV]	E7	CaSki	mRNA	0	18755502	Blast SL	refseqs
virsi1751	caccuacauugcaugaaua	Human Papillomavirus [HPV]	E7	CaSki	mRNA	0	18755502	Blast SL	refseqs
virsi1732	uguguguacugcaagcaac	Human Papillomavirus [HPV]	E6	HeLa	mRNA	0	15908516	Blast SL	refseqs
virsi1734	cagaaaaacuuagacaccu	Human Papillomavirus [HPV]	E6	HeLa	Protein	0	16810314	Blast SL	refseqs



« previous1234next »

: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm