VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for Papillomaviridae are 87
Results from 0 - 25

« previous1234next »
siRNA sequence "aagagcugaaacaacuauac" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "aagagcugaaacaacuauac" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi2181 " record
Length: 20
GC Content:35 %
Strain of Virus: 16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48

Offtargets for "aagagcugaaacaacuauac" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:15763658
Article:Human papillomavirus-16 associated squamous cell carcinoma of the head and neck (SCCHN): a natural disease model provides insights into viral carcinogenesis.
Authors:Ferris RL, Martinez I, Sirianni N, Wang J, López-Albaitero A, Gollin SM, Johnson JT, Khan S.
Journal:Eur J Cancer. 2005 Mar;41(5):807-15.
Entrez:15763658

siRNA sequence "gggaauccauaugcuguaugu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gggaauccauaugcuguaugu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1705 " record
Length: 21
GC Content:43 %
Starting position: 272
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Calcium Phosohate
Incubation Time (Hours):24

Offtargets for "gggaauccauaugcuguaugu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:19276448
Article:E6 and e7 gene silencing and transformed phenotype of human papillomavirus 16-positive oropharyngeal cancer cells.
Authors:Rampias T, Sasaki C, Weinberger P, Psyrri A.
Journal:J Natl Cancer Inst. 2009 Mar 18;101(6):412-23. Epub 2009 Mar 10.
Entrez:19276448

siRNA sequence "aauguguguacugcaagcaac" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "aauguguguacugcaagcaac" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1707 " record
Length: 21
GC Content:43 %
Starting position: 189
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Calcium Phosohate
Incubation Time (Hours):24

Offtargets for "aauguguguacugcaagcaac" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:19276448
Article:E6 and e7 gene silencing and transformed phenotype of human papillomavirus 16-positive oropharyngeal cancer cells.
Authors:Rampias T, Sasaki C, Weinberger P, Psyrri A.
Journal:J Natl Cancer Inst. 2009 Mar 18;101(6):412-23. Epub 2009 Mar 10.
Entrez:19276448

siRNA sequence "ggacagagcccauuacaauau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ggacagagcccauuacaauau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1708 " record
Length: 21
GC Content:43 %
Starting position: 702
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Calcium Phosohate
Incubation Time (Hours):24

Offtargets for "ggacagagcccauuacaauau" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:19276448
Article:E6 and e7 gene silencing and transformed phenotype of human papillomavirus 16-positive oropharyngeal cancer cells.
Authors:Rampias T, Sasaki C, Weinberger P, Psyrri A.
Journal:J Natl Cancer Inst. 2009 Mar 18;101(6):412-23. Epub 2009 Mar 10.
Entrez:19276448

siRNA sequence "gcccauuacaauauuguaacc" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcccauuacaauauuguaacc" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1709 " record
Length: 21
GC Content:38 %
Starting position: 709
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Calcium Phosohate
Incubation Time (Hours):24

Offtargets for "gcccauuacaauauuguaacc" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:19276448
Article:E6 and e7 gene silencing and transformed phenotype of human papillomavirus 16-positive oropharyngeal cancer cells.
Authors:Rampias T, Sasaki C, Weinberger P, Psyrri A.
Journal:J Natl Cancer Inst. 2009 Mar 18;101(6):412-23. Epub 2009 Mar 10.
Entrez:19276448

siRNA sequence "ggucgauguaugucuuguugc" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ggucgauguaugucuuguugc" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1712 " record
Length: 21
GC Content:48 %
Starting position: 503
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24

Offtargets for "ggucgauguaugucuuguugc" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:19174559
Article:Inhibition of cervical cancer cell growth by human papillomavirus virus-like particles packaged with human papillomavirus oncoprotein short hairpin RNAs.
Authors:Bousarghin L, Touze A, Gaud G, Iochmann S, Alvarez E, Reverdiau P, Gaitan J, Jourdan ML, Sizaret PY, Coursaget PL.
Journal:Mol Cancer Ther. 2009 Feb;8(2):357-65. Epub 2009 Jan 27.
Entrez:19174559

siRNA sequence "uaaccuguguauauugcaa" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi2352 " record
Length: 19
GC Content:32 %
Strain of Virus: HPV18
Transfection Reagent: Oligofectamine

Offtargets for "uaaccuguguauauugcaa" siRNA in Human Genome sequences
See at Genbank
Pubmed:21630254
Article:The synergistic therapeutic effect of cisplatin with Human papillomavirus E6/E7 short interfering RNA on cervical cancer cell lines in vitro and in vivo.
Authors:Jung HS, Erkin OC, Kwon MJ, Kim SH, Jung JI, Oh YK, Her SW, Ju W, Choi YL, Song SY, Kim JK, Kim YD, Shim GY, Shin YK. Int J Cancer. 2011 May 31. doi: 10.1002/ijc.26197. [Epub ahead of print] Int J Cancer. 2011 21630254
Journal:
Entrez:

siRNA sequence "cuaacuaacacuggguuau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi2353 " record
Length: 19
GC Content:37 %
Strain of Virus: HPV18
Transfection Reagent: Oligofectamine

Offtargets for "cuaacuaacacuggguuau" siRNA in Human Genome sequences
See at Genbank
Pubmed:21630254
Article:The synergistic therapeutic effect of cisplatin with Human papillomavirus E6/E7 short interfering RNA on cervical cancer cell lines in vitro and in vivo.
Authors:Jung HS, Erkin OC, Kwon MJ, Kim SH, Jung JI, Oh YK, Her SW, Ju W, Choi YL, Song SY, Kim JK, Kim YD, Shim GY, Shin YK. Int J Cancer. 2011 May 31. doi: 10.1002/ijc.26197. [Epub ahead of print] Int J Cancer. 2011 21630254
Journal:
Entrez:

siRNA sequence "gacauuauucagacucugu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gacauuauucagacucugu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1728 " record
Length: 19
GC Content:37 %
Starting position: 340
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):96

Offtargets for "gacauuauucagacucugu" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:15908516
Article:Chemotherapy compounds in cervical cancer cells primed by reconstitution of p53 function after short interfering RNA-mediated degradation of human papillomavirus 18 E6 mRNA: opposite effect of siRNA in combination with different drugs.
Authors:Koivusalo R, Krausz E, Helenius H, Hietanen S.
Journal:Mol Pharmacol. 2005 Aug;68(2):372-82. Epub 2005 May 20.
Entrez:15908516

siRNA sequence "uccauaugcuguaugugau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "uccauaugcuguaugugau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi2168 " record
Length: 19
GC Content:37 %
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24

Offtargets for "uccauaugcuguaugugau" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16611884
Article:The E7 oncoprotein is translated from spliced E6*I transcripts in high-risk human papillomavirus type 16- or type 18-positive cervical cancer cell lines via translation reinitiation.
Authors:Tang S, Tao M, McCoy JP Jr, Zheng ZM.
Journal:J Virol. 2006 May;80(9):4249-63.
Entrez:16611884

siRNA sequence "ggucgauguaugucuuguugc" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ggucgauguaugucuuguugc" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1706 " record
Length: 21
GC Content:48 %
Starting position: 503
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Calcium Phosohate
Incubation Time (Hours):24

Offtargets for "ggucgauguaugucuuguugc" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:19276448
Article:E6 and e7 gene silencing and transformed phenotype of human papillomavirus 16-positive oropharyngeal cancer cells.
Authors:Rampias T, Sasaki C, Weinberger P, Psyrri A.
Journal:J Natl Cancer Inst. 2009 Mar 18;101(6):412-23. Epub 2009 Mar 10.
Entrez:19276448

siRNA sequence "cucuguguauggagacaca" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cucuguguauggagacaca" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi2169 " record
Length: 19
GC Content:47 %
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24

Offtargets for "cucuguguauggagacaca" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16611884
Article:The E7 oncoprotein is translated from spliced E6*I transcripts in high-risk human papillomavirus type 16- or type 18-positive cervical cancer cell lines via translation reinitiation.
Authors:Tang S, Tao M, McCoy JP Jr, Zheng ZM.
Journal:J Virol. 2006 May;80(9):4249-63.
Entrez:16611884

siRNA sequence "uacaacaaaccguugugug" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "uacaacaaaccguugugug" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1703 " record
Length: 19
GC Content:42 %
Starting position: 377
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48

Offtargets for "uacaacaaaccguugugug" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:12955072
Article:siRNA targeting of the viral E6 oncogene efficiently kills human papillomavirus-positive cancer cells.
Authors:Butz K, Ristriani T, Hengstermann A, Denk C, Scheffner M, Hoppe-Seyler F.
Journal:Oncogene. 2003 Sep 4;22(38):5938-45.
Entrez:12955072

siRNA sequence "aacugcgacgugagguauaug" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "aacugcgacgugagguauaug" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi2182 " record
Length: 21
GC Content:48 %
Strain of Virus: 16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48

Offtargets for "aacugcgacgugagguauaug" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:15763658
Article:Human papillomavirus-16 associated squamous cell carcinoma of the head and neck (SCCHN): a natural disease model provides insights into viral carcinogenesis.
Authors:Ferris RL, Martinez I, Sirianni N, Wang J, López-Albaitero A, Gollin SM, Johnson JT, Khan S.
Journal:Eur J Cancer. 2005 Mar;41(5):807-15.
Entrez:15763658

siRNA sequence "gagguauaugacuuugcuuuu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gagguauaugacuuugcuuuu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1713 " record
Length: 21
GC Content:33 %
Starting position: 224
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine
Incubation Time (Hours):24

Offtargets for "gagguauaugacuuugcuuuu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:19174559
Article:Inhibition of cervical cancer cell growth by human papillomavirus virus-like particles packaged with human papillomavirus oncoprotein short hairpin RNAs.
Authors:Bousarghin L, Touze A, Gaud G, Iochmann S, Alvarez E, Reverdiau P, Gaitan J, Jourdan ML, Sizaret PY, Coursaget PL.
Journal:Mol Cancer Ther. 2009 Feb;8(2):357-65. Epub 2009 Jan 27.
Entrez:19174559

siRNA sequence "ccuguguauauugcaagac" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ccuguguauauugcaagac" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1701 " record
Length: 19
GC Content:42 %
Starting position: 196
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48

Offtargets for "ccuguguauauugcaagac" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:16138119
Article:Induction of cell death in human papillomavirus 18-positive cervical cancer cells by E6 siRNA.
Authors:Yamato K, Fen J, Kobuchi H, Nasu Y, Yamada T, Nishihara T, Ikeda Y, Kizaki M, Yoshinouchi M.
Journal:Cancer Gene Ther. 2006 Mar;13(3):234-41.
Entrez:16138119

siRNA sequence "gagguauuugaauuugcau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gagguauuugaauuugcau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1700 " record
Length: 19
GC Content:32 %
Starting position: 231
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48

Offtargets for "gagguauuugaauuugcau" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:16138119
Article:Induction of cell death in human papillomavirus 18-positive cervical cancer cells by E6 siRNA.
Authors:Yamato K, Fen J, Kobuchi H, Nasu Y, Yamada T, Nishihara T, Ikeda Y, Kizaki M, Yoshinouchi M.
Journal:Cancer Gene Ther. 2006 Mar;13(3):234-41.
Entrez:16138119

siRNA sequence "uguguguacugcaagcaac" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "uguguguacugcaagcaac" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1720 " record
Length: 19
GC Content:47 %
Starting position: 191
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Genejammer
Incubation Time (Hours):14 Days

Offtargets for "uguguguacugcaagcaac" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16681752
Article:Extended effects of human papillomavirus 16 E6-specific short hairpin RNA on cervical carcinoma cells.
Authors:Bai L, Wei L, Wang J, Li X, He P.
Journal:Int J Gynecol Cancer. 2006 Mar-Apr;16(2):718-29.
Entrez:16681752

siRNA sequence "ggaagaaaacgaugaaaua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ggaagaaaacgaugaaaua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1731 " record
Length: 19
GC Content:32 %
Starting position: 694
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):96

Offtargets for "ggaagaaaacgaugaaaua" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:15908516
Article:Chemotherapy compounds in cervical cancer cells primed by reconstitution of p53 function after short interfering RNA-mediated degradation of human papillomavirus 18 E6 mRNA: opposite effect of siRNA in combination with different drugs.
Authors:Koivusalo R, Krausz E, Helenius H, Hietanen S.
Journal:Mol Pharmacol. 2005 Aug;68(2):372-82. Epub 2005 May 20.
Entrez:15908516

siRNA sequence "aggaggaugaaauagaugg" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "aggaggaugaaauagaugg" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1767 " record
Length: 19
GC Content:42 %
Starting position: 662
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72

Offtargets for "aggaggaugaaauagaugg" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:15665592
Article:Gel-based application of siRNA to human epithelial cancer cells induces RNAi-dependent apoptosis.
Authors:Jiang M, Rubbi CP, Milner J.
Journal:Oligonucleotides. 2004 Winter;14(4):239-48.
Entrez:15665592

siRNA sequence "caguuacugcgacgugaggu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "caguuacugcgacgugaggu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1721 " record
Length: 20
GC Content:55 %
Starting position: 209
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Genejammer
Incubation Time (Hours):14 Days

Offtargets for "caguuacugcgacgugaggu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16681752
Article:Extended effects of human papillomavirus 16 E6-specific short hairpin RNA on cervical carcinoma cells.
Authors:Bai L, Wei L, Wang J, Li X, He P.
Journal:Int J Gynecol Cancer. 2006 Mar-Apr;16(2):718-29.
Entrez:16681752

siRNA sequence "uguguacugcaagcaacag" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "uguguacugcaagcaacag" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1704 " record
Length: 19
GC Content:47 %
Starting position: 193
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: TransMessenger
Incubation Time (Hours):48

Offtargets for "uguguacugcaagcaacag" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16681755
Article:Inhibition of HPV 16 E6 oncogene expression by RNA interference in vitro and in vivo.
Authors:Niu XY, Peng ZL, Duan WQ, Wang H, Wang P.
Journal:Int J Gynecol Cancer. 2006 Mar-Apr;16(2):743-51.
Entrez:16681755

siRNA sequence "ucucuacuguuaugagcaauua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ucucuacuguuaugagcaauua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1740 " record
Length: 22
GC Content:32 %
Starting position: 624
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24

Offtargets for "ucucuacuguuaugagcaauua" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450

siRNA sequence "ggcaacauugcaagacauu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ggcaacauugcaagacauu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1730 " record
Length: 19
GC Content:42 %
Starting position: 604
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48

Offtargets for "ggcaacauugcaagacauu" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:15908516
Article:Chemotherapy compounds in cervical cancer cells primed by reconstitution of p53 function after short interfering RNA-mediated degradation of human papillomavirus 18 E6 mRNA: opposite effect of siRNA in combination with different drugs.
Authors:Koivusalo R, Krausz E, Helenius H, Hietanen S.
Journal:Mol Pharmacol. 2005 Aug;68(2):372-82. Epub 2005 May 20.
Entrez:15908516

siRNA sequence "cuucgguugugcguacaaagc" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cuucgguugugcguacaaagc" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1760 " record
Length: 21
GC Content:52 %
Starting position: 754
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "cuucgguugugcguacaaagc" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi2181	aagagcugaaacaacuauac	Human Papillomavirus [HPV]	E6	Upci:Scc090	mRNA	Medium	15763658	Blast SL	refseqs
virsi1705	gggaauccauaugcuguaugu	Human Papillomavirus [HPV]	E6 / E7	147T	mRNA	Medium	19276448	Blast SL	refseqs
virsi1707	aauguguguacugcaagcaac	Human Papillomavirus [HPV]	E6 / E7	147T	mRNA	Medium	19276448	Blast SL	refseqs
virsi1708	ggacagagcccauuacaauau	Human Papillomavirus [HPV]	E6 / E7	147T	mRNA	Medium	19276448	Blast SL	refseqs
virsi1709	gcccauuacaauauuguaacc	Human Papillomavirus [HPV]	E6 / E7	147T	mRNA	Medium	19276448	Blast SL	refseqs
virsi1712	ggucgauguaugucuuguugc	Human Papillomavirus [HPV]	E6	CaSki	mRNA	Medium	19174559	Blast SL	refseqs
virsi2352	uaaccuguguauauugcaa	Human Papillomavirus [HPV]	E6 / E7	HeLa	mRNA	Medium	21630254	Blast SL	refseqs
virsi2353	cuaacuaacacuggguuau	Human Papillomavirus [HPV]	E6	HeLa	mRNA	Medium	21630254	Blast SL	refseqs
virsi1728	gacauuauucagacucugu	Human Papillomavirus [HPV]	E6	HeLa	mRNA	Low	15908516	Blast SL	refseqs
virsi2168	uccauaugcuguaugugau	Human Papillomavirus [HPV]	E7	CaSki	mRNA	Low	16611884	Blast SL	refseqs
virsi1706	ggucgauguaugucuuguugc	Human Papillomavirus [HPV]	E6 / E7	147T	mRNA	Low	19276448	Blast SL	refseqs
virsi2169	cucuguguauggagacaca	Human Papillomavirus [HPV]	E6	CaSki	mRNA	High	16611884	Blast SL	refseqs
virsi1703	uacaacaaaccguugugug	Human Papillomavirus [HPV]	E6	HeLa	mRNA	High	12955072	Blast SL	refseqs
virsi2182	aacugcgacgugagguauaug	Human Papillomavirus [HPV]	E6	Upci:Scc090	mRNA	High	15763658	Blast SL	refseqs
virsi1713	gagguauaugacuuugcuuuu	Human Papillomavirus [HPV]	E6	CaSki	mRNA	100	19174559	Blast SL	refseqs
virsi1701	ccuguguauauugcaagac	Human Papillomavirus [HPV]	E6	HeLa/SW756	mRNA	97	16138119	Blast SL	refseqs
virsi1700	gagguauuugaauuugcau	Human Papillomavirus [HPV]	E6	HeLa/SW756	mRNA	96	16138119	Blast SL	refseqs
virsi1720	uguguguacugcaagcaac	Human Papillomavirus [HPV]	E6	SiHa	mRNA	90	16681752	Blast SL	refseqs
virsi1731	ggaagaaaacgaugaaaua	Human Papillomavirus [HPV]	E7	HeLa	mRNA	85	15908516	Blast SL	refseqs
virsi1767	aggaggaugaaauagaugg	Human Papillomavirus [HPV]	E7	SiHa	mRNA	85	15665592	Blast SL	refseqs
virsi1721	caguuacugcgacgugaggu	Human Papillomavirus [HPV]	E6	SiHa	mRNA	85	16681752	Blast SL	refseqs
virsi1704	uguguacugcaagcaacag	Human Papillomavirus [HPV]	E6	CaSki	mRNA	83	16681755	Blast SL	refseqs
virsi1740	ucucuacuguuaugagcaauua	Human Papillomavirus [HPV]	E7	HeLa	mRNA	82	20885450	Blast SL	refseqs
virsi1730	ggcaacauugcaagacauu	Human Papillomavirus [HPV]	E7	HeLa	mRNA	80	15908516	Blast SL	refseqs
virsi1760	cuucgguugugcguacaaagc	Human Papillomavirus [HPV]	E7	SiHa	mRNA	76	18157144	Blast SL	refseqs



« previous1234next »

: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm