VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for S are 87
Results from 25 - 50

« previous1234next »
siRNA sequence "gcucccgcgugucuuggcc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gcucccgcgugucuuggcc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1307 " record
Length: 19
GC Content:74 %
Starting position: 287
Strain of Virus: ayw
GenBank Acc: AB048705
Transfection Reagent: Sofast
Incubation Time (Hours):48

Offtargets for "gcucccgcgugucuuggcc" siRNA in Human Genome sequences
See AB048705 at Genbank
Pubmed:16022904
Article:Inhibition of Hepatitis B virus gene expression by single and dual small interfering RNA treatment.
Authors:Wu KL, Zhang X, Zhang J, Yang Y, Mu YX, Liu M, Lu L, Li Y, Zhu Y, Wu J.
Journal:Virus Res. 2005 Sep;112(1-2):100-7. Epub 2005 Apr 26.
Entrez:16022904

siRNA sequence "agucuagacucgugguggacu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "agucuagacucgugguggacu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1952 " record
Length: 21
GC Content:52 %
Starting position: 91
GenBank Acc: HQ641713
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):96

Offtargets for "agucuagacucgugguggacu" siRNA in Human Genome sequences
See HQ641713 at Genbank
Pubmed:20696079
Article:RNA Interference inhibits hepatitis B virus of different genotypes in vitro and in vivo.
Authors:Zhang YL, Cheng T, Cai YJ, Yuan Q, Liu C, Zhang T, Xia DZ, Li RY, Yang LW, Wang YB, Yeo AE, Shih JW, Zhang J, Xia NS.
Journal:BMC Microbiol. 2010 Aug 10;10:214.
Entrez:20696079

siRNA sequence "caucacaucaggauuccua" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "caucacaucaggauuccua" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1675 " record
Length: 19
GC Content:42 %
Starting position: 163
GenBank Acc: FR714498
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "caucacaucaggauuccua" siRNA in Human Genome sequences
See FR714498 at Genbank
Pubmed:18685862
Article:Inhibition of hepatitis B virus replication by small interference RNA induces expression of MICA in HepG2.2.15 cells.
Authors:Tang KF, Chen M, Xie J, Song GB, Shi YS, Liu Q, Mei ZC, Steinle A, Ren H.
Journal:Med Microbiol Immunol. 2009 Feb;198(1):27-32. Epub 2008 Aug 7.
Entrez:18685862

siRNA sequence "gguauguugcccguuuguc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gguauguugcccguuuguc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1067 " record
Length: 19
GC Content:53 %
Starting position: 460
Transfection Reagent: Polymer Polyethylenimine (PEI)
Incubation Time (Hours):48

Offtargets for "gguauguugcccguuuguc" siRNA in Human Genome sequences
See at Genbank
Pubmed:15756649
Article:Stable inhibition of hepatitis B virus proteins by small interfering RNA expressed from viral vectors.
Authors:Moore MD, McGarvey MJ, Russell RA, Cullen BR, McClure MO.
Journal:J Gene Med. 2005 Jul;7(7):918-25.
Entrez:15756649

siRNA sequence "gguauguugcccguuuguc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gguauguugcccguuuguc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1956 " record
Length: 19
GC Content:53 %
Starting position: 304
GenBank Acc: HQ641713
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48

Offtargets for "gguauguugcccguuuguc" siRNA in Human Genome sequences
See HQ641713 at Genbank
Pubmed:20801205
Article:Evaluation of cationic nanoparticles of biodegradable copolymers as siRNA delivery system for hepatitis B treatment.
Authors:Wang J, Feng SS, Wang S, Chen ZY.
Journal:Int J Pharm. 2010 Nov 15;400(1-2):194-200. Epub 2010 Aug 27.
Entrez:20801205

siRNA sequence "gguauguugcccguuuguc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gguauguugcccguuuguc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1960 " record
Length: 19
GC Content:53 %
Starting position: 460
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gguauguugcccguuuguc" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:20642484
Article:Knockdown of HBV surface antigen gene expression by a lentiviral microRNA-based system inhibits HBV replication and HCC growth.
Authors:Xiangji L, Feng X, Qingbao C, Weifeng T, Xiaoqing J, Baihe Z, Feng S, Hongyang W, Mengchao W.
Journal:J Viral Hepat. 2011 Sep;18(9):653-60. doi: 10.1111/j.1365-2893.2010.01346.x. Epub 2010 Jul 19.
Entrez:20642484

siRNA sequence "gguauguugcccguuuguc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gguauguugcccguuuguc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1007 " record
Length: 19
GC Content:53 %
Starting position: 458
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "gguauguugcccguuuguc" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18378325
Article:Inhibition of hepatitis B virus gene expression and replication by endoribonuclease-prepared siRNA.
Authors:Meng Z, Xu Y, Wu J, Tian Y, Kemper T, Bleekmann B, Roggendorf M, Yang D, Lu M.
Journal:J Virol Methods. 2008 Jun;150(1-2):27-33. Epub 2008 Apr 18.
Entrez:18378325

siRNA sequence "gguggacuucucucaauuu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gguggacuucucucaauuu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1308 " record
Length: 19
GC Content:42 %
Starting position: 258
Strain of Virus: ayw
GenBank Acc: AB048705
Transfection Reagent: Sofast
Incubation Time (Hours):48

Offtargets for "gguggacuucucucaauuu" siRNA in Human Genome sequences
See AB048705 at Genbank
Pubmed:16022904
Article:Inhibition of Hepatitis B virus gene expression by single and dual small interfering RNA treatment.
Authors:Wu KL, Zhang X, Zhang J, Yang Y, Mu YX, Liu M, Lu L, Li Y, Zhu Y, Wu J.
Journal:Virus Res. 2005 Sep;112(1-2):100-7. Epub 2005 Apr 26.
Entrez:16022904

siRNA sequence "gcacuucgcuucaccucugca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gcacuucgcuucaccucugca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1954 " record
Length: 21
GC Content:57 %
Starting position: 1526
GenBank Acc: FJ589068
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):96

Offtargets for "gcacuucgcuucaccucugca" siRNA in Human Genome sequences
See FJ589068 at Genbank
Pubmed:20696079
Article:RNA Interference inhibits hepatitis B virus of different genotypes in vitro and in vivo.
Authors:Zhang YL, Cheng T, Cai YJ, Yuan Q, Liu C, Zhang T, Xia DZ, Li RY, Yang LW, Wang YB, Yeo AE, Shih JW, Zhang J, Xia NS.
Journal:BMC Microbiol. 2010 Aug 10;10:214.
Entrez:20696079

siRNA sequence "gguggacuucucucaauuu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gguggacuucucucaauuu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi2011 " record
Length: 19
GC Content:42 %
Starting position: 258
Strain of Virus: ayw
GenBank Acc: AB048705
Transfection Reagent: Sofast
Incubation Time (Hours):48

Offtargets for "gguggacuucucucaauuu" siRNA in Human Genome sequences
See AB048705 at Genbank
Pubmed:16022904
Article:Inhibition of Hepatitis B virus gene expression by single and dual small interfering RNA treatment.
Authors:Wu KL, Zhang X, Zhang J, Yang Y, Mu YX, Liu M, Lu L, Li Y, Zhu Y, Wu J.
Journal:Virus Res. 2005 Sep;112(1-2):100-7. Epub 2005 Apr 26.
Entrez:16022904

siRNA sequence "gucuguacagcaucuugag" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gucuguacagcaucuugag" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1077 " record
Length: 19
GC Content:47 %
Starting position: 767
Transfection Reagent: Polymer Polyethylenimine (PEI)
Incubation Time (Hours):48

Offtargets for "gucuguacagcaucuugag" siRNA in Human Genome sequences
See at Genbank
Pubmed:15756649
Article:Stable inhibition of hepatitis B virus proteins by small interfering RNA expressed from viral vectors.
Authors:Moore MD, McGarvey MJ, Russell RA, Cullen BR, McClure MO.
Journal:J Gene Med. 2005 Jul;7(7):918-25.
Entrez:15756649

siRNA sequence "gucuguacaacaucuugag" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gucuguacaacaucuugag" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1090 " record
Length: 19
GC Content:42 %
Starting position: 765
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72

Offtargets for "gucuguacaacaucuugag" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:15754419
Article:Combination of small interfering RNAs mediates greater inhibition of human hepatitis B virus replication and antigen expression.
Authors:Chen Z, Xu ZF, Ye JJ, Yao HP, Zheng S, Ding JY.
Journal:J Zhejiang Univ Sci B. 2005 Apr;6(4):236-41.
Entrez:15754419

siRNA sequence "ccuccaaucacucaccaac" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ccuccaaucacucaccaac" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1157 " record
Length: 19
GC Content:53 %
Starting position: 324
Strain of Virus: ayr
GenBank Acc: X04615
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "ccuccaaucacucaccaac" siRNA in Human Genome sequences
See X04615 at Genbank
Pubmed:15316660
Article:Genome-wide expression profiling of RNA interference of hepatitis B virus gene expression and replication.
Authors:Li Y, Wasser S, Lim SG, Tan TM.
Journal:Cell Mol Life Sci. 2004 Aug;61(16):2113-24.
Entrez:15316660

siRNA sequence "cuaccgugugucuuggcca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "cuaccgugugucuuggcca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1073 " record
Length: 19
GC Content:58 %
Starting position: 290
Transfection Reagent: Polymer Polyethylenimine (PEI)
Incubation Time (Hours):48

Offtargets for "cuaccgugugucuuggcca" siRNA in Human Genome sequences
See at Genbank
Pubmed:15756649
Article:Stable inhibition of hepatitis B virus proteins by small interfering RNA expressed from viral vectors.
Authors:Moore MD, McGarvey MJ, Russell RA, Cullen BR, McClure MO.
Journal:J Gene Med. 2005 Jul;7(7):918-25.
Entrez:15756649

siRNA sequence "ggaaccucuauguaucccu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ggaaccucuauguaucccu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1008 " record
Length: 19
GC Content:47 %
Starting position: 542
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "ggaaccucuauguaucccu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18378325
Article:Inhibition of hepatitis B virus gene expression and replication by endoribonuclease-prepared siRNA.
Authors:Meng Z, Xu Y, Wu J, Tian Y, Kemper T, Bleekmann B, Roggendorf M, Yang D, Lu M.
Journal:J Virol Methods. 2008 Jun;150(1-2):27-33. Epub 2008 Apr 18.
Entrez:18378325

siRNA sequence "gucuguacagcaucuugag" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gucuguacagcaucuugag" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1444 " record
Length: 19
GC Content:47 %
Starting position: 765
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Oligofectamine
Incubation Time (Hours):120

Offtargets for "gucuguacagcaucuugag" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:17245534
Article:Inhibition of hepatitis B virus replication by shRNAs in stably HBV expressed HEPG2 2.2.15 cell lines.
Authors:Kayhan H, Karatayli E, Turkyilmaz AR, Sahin F, Yurdaydin C, Bozdayi AM.
Journal:Arch Virol. 2007;152(5):871-9. Epub 2007 Jan 25.
Entrez:17245534

siRNA sequence "gugguggacuucucucaau" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gugguggacuucucucaau" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1020 " record
Length: 19
GC Content:47 %
Starting position: 256
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "gugguggacuucucucaau" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18274934
Article:siRNA pool targeting different sites of human hepatitis B surface antigen efficiently inhibits HBV infection.
Authors:Chen Y, Mahato RI.
Journal:J Drug Target. 2008 Feb;16(2):140-8.
Entrez:18274934

siRNA sequence "aaauugcaccuguauucccau" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aaauugcaccuguauucccau" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1151 " record
Length: 21
GC Content:38 %
Starting position: 591
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24

Offtargets for "aaauugcaccuguauucccau" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16298967
Article:Inhibition of hepatitis B virus replication by various RNAi constructs and their pharmacodynamic properties.
Authors:Peng J, Zhao Y, Mai J, Pang WK, Wei X, Zhang P, Xu Y.
Journal:J Gen Virol. 2005 Dec;86(Pt 12):3227-34.
Entrez:16298967

siRNA sequence "gaauccucacaauaccgca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gaauccucacaauaccgca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1070 " record
Length: 19
GC Content:47 %
Starting position: 227
Transfection Reagent: Polymer Polyethylenimine (PEI)
Incubation Time (Hours):48

Offtargets for "gaauccucacaauaccgca" siRNA in Human Genome sequences
See at Genbank
Pubmed:15756649
Article:Stable inhibition of hepatitis B virus proteins by small interfering RNA expressed from viral vectors.
Authors:Moore MD, McGarvey MJ, Russell RA, Cullen BR, McClure MO.
Journal:J Gene Med. 2005 Jul;7(7):918-25.
Entrez:15756649

siRNA sequence "ggcugcuaugccucaucuucu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ggcugcuaugccucaucuucu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1080 " record
Length: 21
GC Content:52 %
Transfection Reagent: Effectene
Incubation Time (Hours):120

Offtargets for "ggcugcuaugccucaucuucu" siRNA in Human Genome sequences
See at Genbank
Pubmed:16254373
Article:Genomic analysis of anti-hepatitis B virus (HBV) activity by small interfering RNA and lamivudine in stable HBV-producing cells.
Authors:Guo Y, Guo H, Zhang L, Xie H, Zhao X, Wang F, Li Z, Wang Y, Ma S, Tao J, Wang W, Zhou Y, Yang W, Cheng J.
Journal:J Virol. 2005 Nov;79(22):14392-403.
Entrez:16254373

siRNA sequence "acgacagucaauugcagacaa" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "acgacagucaauugcagacaa" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1668 " record
Length: 21
GC Content:43 %
Starting position: 632
GenBank Acc: M19183
Transfection Reagent: Lipofectamine
Incubation Time (Hours):72

Offtargets for "acgacagucaauugcagacaa" siRNA in Human Genome sequences
See M19183 at Genbank
Pubmed:19064272
Article:Inhibition of woodchuck hepatitis virus gene expression in primary hepatocytes by siRNA enhances the cellular gene expression.
Authors:Meng Z, Qiu S, Zhang X, Wu J, Schreiter T, Xu Y, Yang D, Roggendorf M, Schlaak J, Lu M.
Journal:Virology. 2009 Feb 5;384(1):88-96. Epub 2008 Dec 6.
Entrez:19064272

siRNA sequence "aaggaaccucuauguaucccu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aaggaaccucuauguaucccu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1150 " record
Length: 21
GC Content:43 %
Starting position: 542
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24

Offtargets for "aaggaaccucuauguaucccu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16298967
Article:Inhibition of hepatitis B virus replication by various RNAi constructs and their pharmacodynamic properties.
Authors:Peng J, Zhao Y, Mai J, Pang WK, Wei X, Zhang P, Xu Y.
Journal:J Gen Virol. 2005 Dec;86(Pt 12):3227-34.
Entrez:16298967

siRNA sequence "caguccccaaccuccaaucacu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "caguccccaaccuccaaucacu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1663 " record
Length: 22
GC Content:55 %
Starting position: 316
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "caguccccaaccuccaaucacu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:15387899
Article:[Establish a screening system for selection of mRNA target sites for HBsAg to construct siRNA with shRNA].
Authors:Yang ZG, Chen Z, Xu N, Ni Q, Pan XC, Jin HY, Li MW.
Journal:Zhonghua Gan Zang Bing Za Zhi. 2004 Sep;12(9):515-8. Chinese.
Entrez:15387899

siRNA sequence "gccaaaauucgcaguccc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gccaaaauucgcaguccc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi2012 " record
Length: 18
GC Content:56 %
Starting position: 303
Strain of Virus: ayw
GenBank Acc: AB048705
Transfection Reagent: Sofast
Incubation Time (Hours):48

Offtargets for "gccaaaauucgcaguccc" siRNA in Human Genome sequences
See AB048705 at Genbank
Pubmed:16022904
Article:Inhibition of Hepatitis B virus gene expression by single and dual small interfering RNA treatment.
Authors:Wu KL, Zhang X, Zhang J, Yang Y, Mu YX, Liu M, Lu L, Li Y, Zhu Y, Wu J.
Journal:Virus Res. 2005 Sep;112(1-2):100-7. Epub 2005 Apr 26.
Entrez:16022904

siRNA sequence "aaccuccaaucacucaccaac" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aaccuccaaucacucaccaac" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1021 " record
Length: 21
GC Content:48 %
Starting position: 322
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "aaccuccaaucacucaccaac" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18274934
Article:siRNA pool targeting different sites of human hepatitis B surface antigen efficiently inhibits HBV infection.
Authors:Chen Y, Mahato RI.
Journal:J Drug Target. 2008 Feb;16(2):140-8.
Entrez:18274934


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1307	gcucccgcgugucuuggcc	Hepatitis B Virus [HBV]	S	BEL-7402	Protein	82	16022904	Blast SL	refseqs
virsi1952	agucuagacucgugguggacu	Hepatitis B Virus [HBV]	S	Huh-7	mRNA	81	20696079	Blast SL	refseqs
virsi1675	caucacaucaggauuccua	Hepatitis B Virus [HBV]	S	HepG2.2.15	RNA	81	18685862	Blast SL	refseqs
virsi1067	gguauguugcccguuuguc	Hepatitis B Virus [HBV]	S	293T	Protein	81	15756649	Blast SL	refseqs
virsi1956	gguauguugcccguuuguc	Hepatitis B Virus [HBV]	S	PLC/PRF/5	Protein	80	20801205	Blast SL	refseqs
virsi1960	gguauguugcccguuuguc	Hepatitis B Virus [HBV]	S	293T	Protein	80	20642484	Blast SL	refseqs
virsi1007	gguauguugcccguuuguc	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	80	18378325	Blast SL	refseqs
virsi1308	gguggacuucucucaauuu	Hepatitis B Virus [HBV]	S	BEL-7402	Protein	80	16022904	Blast SL	refseqs
virsi1954	gcacuucgcuucaccucugca	Hepatitis B Virus [HBV]	S	Huh-7	mRNA	79	20696079	Blast SL	refseqs
virsi2011	gguggacuucucucaauuu	Hepatitis B Virus [HBV]	S	HepG2.2.15	DNA	78	16022904	Blast SL	refseqs
virsi1077	gucuguacagcaucuugag	Hepatitis B Virus [HBV]	S	293T	Protein	78	15756649	Blast SL	refseqs
virsi1090	gucuguacaacaucuugag	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	76	15754419	Blast SL	refseqs
virsi1157	ccuccaaucacucaccaac	Hepatitis B Virus [HBV]	S	HepG2.2.15	mRNA	75	15316660	Blast SL	refseqs
virsi1073	cuaccgugugucuuggcca	Hepatitis B Virus [HBV]	S	293T	Protein	74	15756649	Blast SL	refseqs
virsi1008	ggaaccucuauguaucccu	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	74	18378325	Blast SL	refseqs
virsi1444	gucuguacagcaucuugag	Hepatitis B Virus [HBV]	S	HepG2.2.15	Viral Load	73	17245534	Blast SL	refseqs
virsi1020	gugguggacuucucucaau	Hepatitis B Virus [HBV]	S	HepG2.2.15	mRNA	72	18274934	Blast SL	refseqs
virsi1151	aaauugcaccuguauucccau	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	71	16298967	Blast SL	refseqs
virsi1070	gaauccucacaauaccgca	Hepatitis B Virus [HBV]	S	293T	Protein	68	15756649	Blast SL	refseqs
virsi1080	ggcugcuaugccucaucuucu	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	67	16254373	Blast SL	refseqs
virsi1668	acgacagucaauugcagacaa	Hepatitis B Virus [HBV]	S	BHK/HepG2	RNA	65	19064272	Blast SL	refseqs
virsi1150	aaggaaccucuauguaucccu	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	65	16298967	Blast SL	refseqs
virsi1663	caguccccaaccuccaaucacu	Hepatitis B Virus [HBV]	S	HeLa	Protein	63	15387899	Blast SL	refseqs
virsi2012	gccaaaauucgcaguccc	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	60	16022904	Blast SL	refseqs
virsi1021	aaccuccaaucacucaccaac	Hepatitis B Virus [HBV]	S	HepG2.2.15	mRNA	59	18274934	Blast SL	refseqs



« previous1234next »

: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm