BLASTN 2.2.24 [Aug-08-2010]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= virsi1131
         (20 letters)

Database: NCBI genome chromosomes - human 
           1495 sequences; 31,910,071,267 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|GL583101.1|  Homo sapiens unplaced genomic scaffold scaff...    28     907
gb|CM000502.1|  Homo sapiens chromosome 12, whole genome sho...    28     907
gb|DS990699.1|  Homo sapiens SCAF_1112675837092 genomic scaf...    28     907
gb|CH003507.1|  Homo sapiens chromosome 12, whole genome sho...    28     907
gb|CH003459.1|  Homo sapiens chromosome 12, whole genome sho...    28     907
ref|NW_925395.1|  Homo sapiens chromosome 12 genomic contig,...    28     907
ref|NT_029419.12|  Homo sapiens chromosome 12 genomic contig...    28     907
ref|NW_001838060.2|  Homo sapiens chromosome 12 genomic cont...    28     907
ref|NC_000012.11|  Homo sapiens chromosome 12, GRCh37.p2 pri...    28     907
ref|AC_000144.1|  Homo sapiens chromosome 12, alternate asse...    28     907
ref|AC_000055.1|  Homo sapiens chromosome 12, alternate asse...    28     907
1_0          1        acacttccgaaactactgtt 20
GL583101     1910443  .......t............ 1910462
CM000502     59075279 .......t............ 59075260
DS990699     14491117 .......t............ 14491136
CH003507     61533760 .......t............ 61533741
CH003459     59462397 .......t............ 59462378
NW_925395    9317561  .......t............ 9317542
NT_029419    24167521 .......t............ 24167502
NW_001838060 14491246 .......t............ 14491265
NC_000012    62024215 .......t............ 62024196
AC_000144    59075331 .......t............ 59075312
AC_000055    61693732 .......t............ 61693713
  Database: NCBI genome chromosomes - human
    Posted date:  Apr 4, 2011  10:12 PM
  Number of letters in database: 31,910,071,267
  Number of sequences in database:  1495
  
Lambda     K      H
   0.192    0.176    0.357 

Gapped
Lambda     K      H
   0.192    0.176    0.357 


Matrix: blastn matrix:5 -4
Gap Penalties: Existence: 25, Extension: 10
Number of Sequences: 1495
Number of Hits to DB: 13,607,046
Number of extensions: 11
Number of successful extensions: 11
Number of sequences better than 1000.0: 11
Number of HSP's gapped: 11
Number of HSP's successfully gapped: 11
Length of query: 20
Length of database: 31,910,071,267
Length adjustment: 14
Effective length of query: 6
Effective length of database: 31,910,050,337
Effective search space: 191460302022
Effective search space used: 191460302022
X1: 73 (20.2 bits)
X2: 108 (29.8 bits)
X3: 361 (99.8 bits)
S1: 91 (27.7 bits)
S2: 91 (27.7 bits)