BLASTN 2.2.24 [Aug-08-2010]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= virsi1144
         (21 letters)

Database: NCBI genome chromosomes - human 
           1495 sequences; 31,910,071,267 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|GL583146.1|  Homo sapiens unplaced genomic scaffold scaff...    28     907
gb|CM000505.1|  Homo sapiens chromosome 15, whole genome sho...    28     907
gb|DS990730.1|  Homo sapiens SCAF_1112675837306 genomic scaf...    28     907
gb|CH003462.1|  Homo sapiens chromosome 15, whole genome sho...    28     907
ref|NW_925940.1|  Homo sapiens chromosome 15 genomic contig,...    28     907
ref|NW_001838222.1|  Homo sapiens chromosome 15 genomic cont...    28     907
ref|NT_010274.17|  Homo sapiens chromosome 15 genomic contig...    28     907
ref|NC_000015.9|  Homo sapiens chromosome 15, GRCh37.p2 prim...    28     907
ref|AC_000147.1|  Homo sapiens chromosome 15, alternate asse...    28     907
ref|AC_000058.1|  Homo sapiens chromosome 15, alternate asse...    28     907
1_0          2        aggtatgttgcccgtttgtc 21
GL583146     3391200  .............t...... 3391219
CM000505     65328785 .............t...... 65328804
DS990730     4180668  .............t...... 4180687
CH003462     65145367 .............t...... 65145386
NW_925940    4110222  .............t...... 4110241
NW_001838222 4180585  .............t...... 4180604
NT_010274    4181956  .............t...... 4181975
NC_000015    89216429 .............t...... 89216448
AC_000147    65328622 .............t...... 65328641
AC_000058    65617402 .............t...... 65617421
  Database: NCBI genome chromosomes - human
    Posted date:  Apr 4, 2011  10:12 PM
  Number of letters in database: 31,910,071,267
  Number of sequences in database:  1495
  
Lambda     K      H
   0.192    0.176    0.357 

Gapped
Lambda     K      H
   0.192    0.176    0.357 


Matrix: blastn matrix:5 -4
Gap Penalties: Existence: 25, Extension: 10
Number of Sequences: 1495
Number of Hits to DB: 16,297,708
Number of extensions: 10
Number of successful extensions: 10
Number of sequences better than 1000.0: 10
Number of HSP's gapped: 10
Number of HSP's successfully gapped: 10
Length of query: 21
Length of database: 31,910,071,267
Length adjustment: 15
Effective length of query: 6
Effective length of database: 31,910,048,842
Effective search space: 191460293052
Effective search space used: 191460293052
X1: 73 (20.2 bits)
X2: 108 (29.8 bits)
X3: 361 (99.8 bits)
S1: 91 (27.7 bits)
S2: 91 (27.7 bits)