BLASTN 2.2.24 [Aug-08-2010]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= virsi1149
         (21 letters)

Database: NCBI genome chromosomes - human 
           1495 sequences; 31,910,071,267 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|GL582984.1|  Homo sapiens unplaced genomic scaffold scaff...    28     907
gb|CM000500.1|  Homo sapiens chromosome 10, whole genome sho...    28     907
gb|DS990677.1|  Homo sapiens SCAF_1112675837177 genomic scaf...    28     907
gb|CH003505.1|  Homo sapiens chromosome 10, whole genome sho...    28     907
gb|CH003457.1|  Homo sapiens chromosome 10, whole genome sho...    28     907
ref|NW_924584.1|  Homo sapiens chromosome 10 genomic contig,...    28     907
ref|NT_008705.16|  Homo sapiens chromosome 10 genomic contig...    28     907
ref|NW_001837931.2|  Homo sapiens chromosome 10 genomic cont...    28     907
ref|NC_000010.10|  Homo sapiens chromosome 10, GRCh37.p2 pri...    28     907
ref|AC_000142.1|  Homo sapiens chromosome 10, alternate asse...    28     907
ref|AC_000053.1|  Homo sapiens chromosome 10, alternate asse...    28     907
1_0          1        aacctccaatcactcaccaa 20
GL582984     10259387 ...a................ 10259368
CM000500     27903161 ...a................ 27903180
DS990677     2879129  ...a................ 2879110
CH003505     29013247 ...a................ 29013266
CH003457     28255615 ...a................ 28255634
NW_924584    27949811 ...a................ 27949830
NT_008705    28126394 ...a................ 28126413
NW_001837931 2878845  ...a................ 2878826
NC_000010    28186394 ...a................ 28186413
AC_000142    27903132 ...a................ 27903151
AC_000053    27949811 ...a................ 27949830
  Database: NCBI genome chromosomes - human
    Posted date:  Apr 4, 2011  10:12 PM
  Number of letters in database: 31,910,071,267
  Number of sequences in database:  1495
  
Lambda     K      H
   0.192    0.176    0.357 

Gapped
Lambda     K      H
   0.192    0.176    0.357 


Matrix: blastn matrix:5 -4
Gap Penalties: Existence: 25, Extension: 10
Number of Sequences: 1495
Number of Hits to DB: 23,660,298
Number of extensions: 11
Number of successful extensions: 11
Number of sequences better than 1000.0: 11
Number of HSP's gapped: 11
Number of HSP's successfully gapped: 11
Length of query: 21
Length of database: 31,910,071,267
Length adjustment: 15
Effective length of query: 6
Effective length of database: 31,910,048,842
Effective search space: 191460293052
Effective search space used: 191460293052
X1: 73 (20.2 bits)
X2: 108 (29.8 bits)
X3: 361 (99.8 bits)
S1: 91 (27.7 bits)
S2: 91 (27.7 bits)