BLASTN 2.2.24 [Aug-08-2010]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= virsi1290
         (21 letters)

Database: NCBI genome chromosomes - human 
           1495 sequences; 31,910,071,267 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|GL583148.1|  Homo sapiens unplaced genomic scaffold scaff...    29     348
gb|GL583204.1|  Homo sapiens unplaced genomic scaffold scaff...    29     348
gb|CM000500.1|  Homo sapiens chromosome 10, whole genome sho...    29     348
gb|CM000506.1|  Homo sapiens chromosome 16, whole genome sho...    29     348
gb|DS990700.1|  Homo sapiens SCAF_1112675837045 genomic scaf...    29     348
gb|DS990710.1|  Homo sapiens SCAF_1112675837089 genomic scaf...    29     348
gb|CH003505.1|  Homo sapiens chromosome 10, whole genome sho...    29     348
gb|CH003511.1|  Homo sapiens chromosome 16, whole genome sho...    29     348
gb|CH003457.1|  Homo sapiens chromosome 10, whole genome sho...    29     348
gb|CH003463.1|  Homo sapiens chromosome 16, whole genome sho...    29     348
ref|NW_926462.1|  Homo sapiens chromosome 16 genomic contig,...    29     348
ref|NW_001838290.1|  Homo sapiens chromosome 16 genomic cont...    29     348
ref|NW_924796.1|  Homo sapiens chromosome 10 genomic contig,...    29     348
ref|NT_010498.15|  Homo sapiens chromosome 16 genomic contig...    29     348
ref|NT_030059.13|  Homo sapiens chromosome 10 genomic contig...    29     348
ref|NW_001837986.1|  Homo sapiens chromosome 10 genomic cont...    29     348
ref|NC_000016.9|  Homo sapiens chromosome 16, GRCh37.p2 prim...    29     348
ref|NC_000010.10|  Homo sapiens chromosome 10, GRCh37.p2 pri...    29     348
ref|AC_000148.1|  Homo sapiens chromosome 16, alternate asse...    29     348
ref|AC_000142.1|  Homo sapiens chromosome 10, alternate asse...    29     348
ref|AC_000059.1|  Homo sapiens chromosome 16, alternate asse...    29     348
ref|AC_000053.1|  Homo sapiens chromosome 10, alternate asse...    29     348
gb|CM000491.1|  Homo sapiens chromosome 1, whole genome shot...    28     907
gb|CM000492.1|  Homo sapiens chromosome 2, whole genome shot...    28     907
gb|GL583006.1|  Homo sapiens unplaced genomic scaffold scaff...    28     907
gb|GL583007.1|  Homo sapiens unplaced genomic scaffold scaff...    28     907
gb|GL583021.1|  Homo sapiens unplaced genomic scaffold scaff...    28     907
gb|GL583037.1|  Homo sapiens unplaced genomic scaffold scaff...    28     907
gb|GL583041.1|  Homo sapiens unplaced genomic scaffold scaff...    28     907
gb|GL583067.1|  Homo sapiens unplaced genomic scaffold scaff...    28     907
gb|GL583072.1|  Homo sapiens unplaced genomic scaffold scaff...    28     907
gb|CM000496.1|  Homo sapiens chromosome 6, whole genome shot...    28     907
gb|CM000497.1|  Homo sapiens chromosome 7, whole genome shot...    28     907
gb|CM000501.1|  Homo sapiens chromosome 11, whole genome sho...    28     907
gb|CM000512.1|  Homo sapiens chromosome 22, whole genome sho...    28     907
gb|DS990660.1|  Homo sapiens SCAF_1112675837341 genomic scaf...    28     907
gb|DS990670.1|  Homo sapiens SCAF_1112675837213 genomic scaf...    28     907
gb|DS990678.1|  Homo sapiens SCAF_1112675837219 genomic scaf...    28     907
gb|DS990685.1|  Homo sapiens SCAF_1112675837317 genomic scaf...    28     907
gb|DS990691.1|  Homo sapiens SCAF_1112675837255 genomic scaf...    28     907
gb|DS990703.1|  Homo sapiens SCAF_1112675837104 genomic scaf...    28     907
gb|CH003496.1|  Homo sapiens chromosome 1, whole genome shot...    28     907
gb|DS990754.1|  Homo sapiens SCAF_1112675837332 genomic scaf...    28     907
gb|DS990979.1|  Homo sapiens SCAF_1112675837106 genomic scaf...    28     907
gb|DS486040.1|  Homo sapiens SCAF_1103279188274 genomic scaf...    28     907
gb|CH003497.1|  Homo sapiens chromosome 2, whole genome shot...    28     907
gb|CH003501.1|  Homo sapiens chromosome 6, whole genome shot...    28     907
gb|CH003506.1|  Homo sapiens chromosome 11, whole genome sho...    28     907
gb|CH003517.1|  Homo sapiens chromosome 22, whole genome sho...    28     907
gb|CH003448.1|  Homo sapiens chromosome 1, whole genome shot...    28     907
gb|CH003449.1|  Homo sapiens chromosome 2, whole genome shot...    28     907
gb|CH003453.1|  Homo sapiens chromosome 6, whole genome shot...    28     907
gb|CH003454.1|  Homo sapiens chromosome 7, whole genome shot...    28     907
gb|CH003458.1|  Homo sapiens chromosome 11, whole genome sho...    28     907
gb|CH003469.1|  Homo sapiens chromosome 22, whole genome sho...    28     907
tpg|BL000002.1|  TPA: Homo sapiens chromosome 7                    28     907
ref|NW_927628.1|  Homo sapiens chromosome 22 genomic contig,...    28     907
ref|NW_927841.1|  Homo sapiens chromosome 1 genomic contig, ...    28     907
ref|NW_001838987.1|  Homo sapiens chromosome 6 genomic conti...    28     907
ref|NW_001838863.1|  Homo sapiens chromosome 2 genomic conti...    28     907
ref|NW_001838745.1|  Homo sapiens chromosome 22 genomic cont...    28     907
ref|NW_001838589.2|  Homo sapiens chromosome 1 genomic conti...    28     907
ref|NW_001838859.2|  Homo sapiens chromosome 2 genomic conti...    28     907
ref|NW_001838573.1|  Homo sapiens chromosome 1 genomic conti...    28     907
ref|NW_923184.1|  Homo sapiens chromosome 6 genomic contig, ...    28     907
ref|NW_921585.1|  Homo sapiens chromosome 2 genomic contig, ...    28     907
ref|NW_921795.1|  Homo sapiens chromosome 1 genomic contig, ...    28     907
ref|NW_921374.1|  Homo sapiens chromosome 2 genomic contig, ...    28     907
ref|NW_925173.1|  Homo sapiens chromosome 11 genomic contig,...    28     907
ref|NT_033968.6|  Homo sapiens chromosome 7 genomic contig, ...    28     907
ref|NT_007299.13|  Homo sapiens chromosome 6 genomic contig,...    28     907
ref|NT_022135.16|  Homo sapiens chromosome 2 genomic contig,...    28     907
ref|NT_005403.17|  Homo sapiens chromosome 2 genomic contig,...    28     907
ref|NT_011520.12|  Homo sapiens chromosome 22 genomic contig...    28     907
ref|NT_004610.19|  Homo sapiens chromosome 1 genomic contig,...    28     907
ref|NT_032977.9|  Homo sapiens chromosome 1 genomic contig, ...    28     907
ref|NT_033899.8|  Homo sapiens chromosome 11 genomic contig,...    28     907
ref|NW_001838042.2|  Homo sapiens chromosome 11 genomic cont...    28     907
ref|NW_001839017.1|  Homo sapiens chromosome 7 genomic conti...    28     907
ref|NT_079592.2|  Homo sapiens chromosome 7 genomic contig, ...    28     907
ref|NW_923295.1|  Homo sapiens chromosome 7 genomic contig, ...    28     907
ref|NC_000001.10|  Homo sapiens chromosome 1, GRCh37.p2 prim...    28     907
ref|NC_000007.13|  Homo sapiens chromosome 7, GRCh37.p2 prim...    28     907
ref|NC_000006.11|  Homo sapiens chromosome 6, GRCh37.p2 prim...    28     907
ref|NC_000022.10|  Homo sapiens chromosome 22, GRCh37.p2 pri...    28     907
ref|NC_000002.11|  Homo sapiens chromosome 2, GRCh37.p2 prim...    28     907
ref|NC_000011.9|  Homo sapiens chromosome 11, GRCh37.p2 prim...    28     907
ref|AC_000139.1|  Homo sapiens chromosome 7, alternate assem...    28     907
ref|AC_000138.1|  Homo sapiens chromosome 6, alternate assem...    28     907
ref|AC_000154.1|  Homo sapiens chromosome 22, alternate asse...    28     907
ref|AC_000134.1|  Homo sapiens chromosome 2, alternate assem...    28     907
ref|AC_000143.1|  Homo sapiens chromosome 11, alternate asse...    28     907
ref|AC_000133.1|  Homo sapiens chromosome 1, alternate assem...    28     907
ref|AC_000068.1|  Homo sapiens chromosome 7, alternate assem...    28     907
ref|AC_000050.1|  Homo sapiens chromosome 7, alternate assem...    28     907
ref|AC_000049.1|  Homo sapiens chromosome 6, alternate assem...    28     907
ref|AC_000065.1|  Homo sapiens chromosome 22, alternate asse...    28     907
ref|AC_000045.1|  Homo sapiens chromosome 2, alternate assem...    28     907
ref|AC_000054.1|  Homo sapiens chromosome 11, alternate asse...    28     907
ref|AC_000044.1|  Homo sapiens chromosome 1, alternate assem...    28     907
1_0          1         aaagaaacagcaaagaaaggg 21
GL583148     4005090   ..............c...... 4005070
GL583204     1818971   ..................a.. 1818991
CM000500     50088276  ..................a.. 50088256
CM000500     60568983  ...............t....  60568964
CM000506     55016230  ..............c...... 55016210
DS990700     1513019   ..................a.. 1512999
DS990700     11993726  ...............t....  11993707
DS990710     13302494  ..............c...... 13302474
CH003505     51131857  ..................a.. 51131837
CH003505     62593513  ...............t....  62593494
CH003511     53740307  ..............c...... 53740287
CH003457     49408262  ..................a.. 49408242
CH003457     59861431  ...............t....  59861412
CH003463     50310094  ..............c...... 50310074
NW_926462    22716873  ..............c...... 22716853
NW_001838290 13302393  ..............c...... 13302373
NW_924796    3561642   ..................a.. 3561622
NW_924796    14040534  ...............t....  14040515
NT_010498    22756949  ..............c...... 22756929
NT_030059    6909000   ..................a.. 6908980
NW_001837986 1513257   ..................a.. 1513237
NC_000016    69142750  ..............c...... 69142730
NC_000010    56104536  ..................a.. 56104516
AC_000148    55015488  ..............c...... 55015468
AC_000142    50088130  ..................a.. 50088110
AC_000059    53652074  ..............c...... 53652054
AC_000053    49367399  ..................a.. 49367379
AC_000053    59846291  ...............t....  59846272
CM000491     17088590  .................t..  17088609
CM000491     88368511  ............t.......  88368492
CM000492     103884151 .........a..........  103884170
CM000492     138869648  ........a........... 138869667
CM000492     170860039 .......a............  170860020
CM000492     185880631 ..................t.  185880650
GL583006     1280411   ..................t.  1280392
GL583006     16183409  .......a............  16183428
GL583007     6195426   ............t.......  6195407
GL583021     13754146  ..........a.........  13754165
GL583037     9145480    ......a............. 9145499
GL583041     8562758   ...............t....  8562739
GL583067     7768684   .................t..  7768665
GL583072     7367142   ..........g.........  7367161
CM000496     91213998  ..........g.........  91214017
CM000497     57216696  ...a................  57216715
CM000501     98642305  ..........a.........  98642286
CM000512     17828377   ......a............. 17828396
DS990660     4416412   .......a............  4416393
DS990660     19437004  ..................t.  19437023
DS990670     18043742  ..........a.........  18043761
DS990678     23452762  ..........g.........  23452781
DS990685     12955251   ......a............. 12955270
DS990691     13860900  ............t.......  13860919
DS990703     2819753    ........a........... 2819734
CH003496     16784258  .................t..  16784277
CH003496     89334986  ............t.......  89334967
DS990754     464177    .................t..  464196
DS990979     479286    ...a................  479305
DS486040     23453097  ..........g.........  23453116
CH003497     148533717  ........a........... 148533736
CH003497     180014930 .......a............  180014911
CH003497     198908365 ..................t.  198908384
CH003501     94028402  ..........g.........  94028421
CH003506     103348331 ..........a.........  103348312
CH003517     19375636   ......a............. 19375655
CH003448     17481980  .................t..  17481999
CH003448     89258396  ............t.......  89258377
CH003449     102906520 .........a..........  102906539
CH003449     138008617  ........a........... 138008636
CH003449     169988990 .......a............  169988971
CH003449     184987310 ..................t.  184987329
CH003453     90604290  ..........g.........  90604309
CH003454     57863592  ...a................  57863611
CH003458     99401313  ..........a.........  99401294
CH003469     17521163   ......a............. 17521182
BL000002     57356868  ...a................  57356887
NW_927628    12940299   ......a............. 12940318
NW_927841    1648456   .................t..  1648475
NW_001838987 23392452  ..........g.........  23392471
NW_001838863 4416516   .......a............  4416497
NW_001838863 19436772  ..................t.  19436791
NW_001838745 12955204   ......a............. 12955223
NW_001838589 13860707  ............t.......  13860726
NW_001838859 2819763    ........a........... 2819744
NW_001838573 464216    .................t..  464235
NW_923184    26483441  ..........g.........  26483460
NW_921585    14779428   ........a........... 14779447
NW_921585    46782438  .......a............  46782419
NW_921585    61805187  ..................t.  61805206
NW_921795    6304538   ............t.......  6304519
NW_921374    1750075   .........a..........  1750094
NW_925173    12745753  ..........a.........  12745734
NT_033968    7206322   ...a................  7206341
NT_007299    32113954  ..........g.........  32113973
NT_022135    175603    .........a..........  175622
NT_022135    36625223   ........a........... 36625242
NT_005403    29199153  .......a............  29199134
NT_005403    44230003  ..................t.  44230022
NT_011520    14262027   ......a............. 14262046
NT_004610    5522253   .................t..  5522272
NT_032977    60223864  ............t.......  60223845
NT_033899    6277662   ..........a.........  6277643
NW_001838042 18043841  ..........a.........  18043860
NW_001839017 479278    ...a................  479297
NT_079592    57571055  ...a................  57571074
NW_923295    439392    ...a................  439411
NC_000001    18842165  .................t..  18842184
NC_000001    90251946  ............t.......  90251927
NC_000007    57616953  ...a................  57616972
NC_000006    93994120  ..........g.........  93994139
NC_000022    34871458   ......a............. 34871477
NC_000002    110426940 .........a..........  110426959
NC_000002    146876560  ........a........... 146876579
NC_000002    178989735 .......a............  178989716
NC_000002    194020585 ..................t.  194020604
NC_000011    102715246 ..........a.........  102715227
AC_000139    57216449  ...a................  57216468
AC_000138    91214250  ..........g.........  91214269
AC_000154    17828071   ......a............. 17828090
AC_000134    103884093 .........a..........  103884112
AC_000134    138869593  ........a........... 138869612
AC_000134    170860210 .......a............  170860191
AC_000134    185880466 ..................t.  185880485
AC_000143    98643168  ..........a.........  98643149
AC_000133    17088485  .................t..  17088504
AC_000133    88369302  ............t.......  88369283
AC_000068    57621055  ...a................  57621074
AC_000050    56341847  ...a................  56341866
AC_000049    94414837  ..........g.........  94414856
AC_000065    18674105   ......a............. 18674124
AC_000045    104595707 .........a..........  104595726
AC_000045    140589625  ........a........... 140589644
AC_000045    172592635 .......a............  172592616
AC_000045    187615384 ..................t.  187615403
AC_000054    99876853  ..........a.........  99876834
AC_000044    17172013  .................t..  17172032
AC_000044    88497644  ............t.......  88497625
  Database: NCBI genome chromosomes - human
    Posted date:  Apr 4, 2011  10:12 PM
  Number of letters in database: 31,910,071,267
  Number of sequences in database:  1495
  
Lambda     K      H
   0.192    0.176    0.357 

Gapped
Lambda     K      H
   0.192    0.176    0.357 


Matrix: blastn matrix:5 -4
Gap Penalties: Existence: 25, Extension: 10
Number of Sequences: 1495
Number of Hits to DB: 62,192,396
Number of extensions: 136
Number of successful extensions: 136
Number of sequences better than 1000.0: 100
Number of HSP's gapped: 136
Number of HSP's successfully gapped: 136
Length of query: 21
Length of database: 31,910,071,267
Length adjustment: 15
Effective length of query: 6
Effective length of database: 31,910,048,842
Effective search space: 191460293052
Effective search space used: 191460293052
X1: 73 (20.2 bits)
X2: 108 (29.8 bits)
X3: 361 (99.8 bits)
S1: 91 (27.7 bits)
S2: 91 (27.7 bits)