This server uses two different methods for prediction-
[1] Structure & Sequence based: predicts with accuracy of 79.94% and requires '.ct file' for submission.
Please take two sequences of ~22 nt which may form a duplex like intermediate similar to during miRNA biogenesis. First ligated both the sequence (miRNA and miRNA*) with 3Ls. For instance sequences (1) mcmv-miR-m01-2 GAAGAGAAUCGGGUUGGAACGGU, and (2)mcmv-miR-m01-2* CGUUCGACACGGUUUCCUUCGA is ligated with 3Ls. Resulting GAAGAGAAUCGGGUUGGAACGGULLLCGUUCGACACGGUUUCCUUCGA. Now calculate the secondary structure of this sequence by using quikfold, at default parameters but using Energy rules RNA (3.0). Now take the output results as: ct file and submit it into our server (RISC_binder) using submission page.
[2] Sequence based: predicts with accuracy of 71.88% and it needs direct submission of your ~22 nt single stranded long
sequence in fasta format.
The user can vary the threshold score between -1.0 to 1.0. The strand achieving score more then the cutoff score are predicted as positive i.e. miRNA otherwise it is predicted as negative (miRNA*). If the user did not select any cutoff score then the default threshold (0) of prediction methods will be used.
Prediction Output: The results of the prediction displayed in user-friendly tabular formats. Tabular form provide information about (1) name of the structure, (2) its sequence, (3) position in whole sequence, (4) score of prediction, and (5) Positive (miRNA) or Negative (miRNA*).
Note:Quikfold may generates more than one structure for a single sequence. This server can also take more then one query sequence at a time.
