Two layered prediction of inhibitory efficacy of Allele specific siRNA for fully complementary mutant allele by ASPsiPred-SVM and wild-type allele with one-mismatch by ASPsiPred-matrix


Load Example


Enter sequences below in FASTA format



Or load file having 2 allele sequence

  


Note: Sequence format: Please enter mutation in small case. For more information see Help page.

>Wild
GTGAGGAGGCGCGTTGAAAATATTGAGGCGCGTTGAAATTGTGAGGAGGCGTGAGG
>Mutant
GTGAGGAGGCGCGTTGAAAATAgTGAGGCGCGTTGAAATTGTGAGGAGGCGTGAGG