Search

Enter Query:     

Search Type:   Containing   Exact

Select Fields	Search in	Display
All
HIVsir ID [e.g, 1398]
HIV Strain [e.g, HIV-1 (NL4-3)]
NCBI Accession [e.g, AF324493]
Target Gene [e.g, LTR]
Position of siRNA target [e.g, 513]
Target Site Sequence [e.g, ACUGCUUAAGCCUCAAUAAUA]
Length of siRNA [e.g, 21]
Efficacy [e.g, 76%]
GC Content [e.g, 33%]
Cell type [e.g, 293 T]
siRNA Source [e.g, siRNA]
Transfection Reagent [e.g, Calcium phosphate method]
Test Objective [e.g, RT Activity]
Test method [e.g, RT Assay]
Test Time [e.g, 96h]
Target Conservation [584(39.04%)]
PubMed ID [e.g, 19110017]

Results per page:   50 100 150 200 250

    

Bioinformatics Center, Institute of Microbial Technology, Chandigarh-160036, India