Home | Search | Advance Search | Browse | HIVsirMut | Tools | Download Online Submission | Documentation & FAQ | Team | Contact

Page - 1 of 1 HIVsir ID HIV Strain NCBI Accession Target Gene Position of siRNA target Sense Sequence of siRNA Efficacy (%) Target Conservation * Cell line PubMed 1668 HIV-1 (NL4-3) AF324493 LTR 246 GGCUUGCUGAAGCGCGCACGG 97.00 83(5.55%) SupT1 cells 19556221 1669 HIV-1 (NL4-3) AF324493 Vif 5049 CAGAUGGCAGGUGAUGAUUGU 92.00 927(61.97%) SupT1 cells 19556221

©2011 HIVsirDB | All Rights Reserved |