| | |
|---|
| ASPsiRNA information |
siRNA Id: | aspsirna0555
|
|
siRNA Name: | siRNA7
|
| Mismatch information |
Wild siRNA (As strand 3'->5'): | AAACGACGAGUCAUACUA
|
|
ASP-siRNA (As strand 3'->5'): | AAACGACGAGUCAUACUG
|
|
Mismatch position in siRNA: | G1A |
| Gene Information |
Gene Name | Collagen type I alpha 2 (COL1A2) |
|
Target Sequence (5'->3'): | TGGGAACTTTGCTGCTCAGTATGATGGAAAAGGAGTTGGACTT
|
|
Wild allele (5'->3'): | UUUGCUGCUCAGUAUGAU
|
|
Mutant allele (5'->3'): | UUUGCUGCUCAGUAUGAC
|
|
Position of siRNA on target gene: | 700-717
|
| Respective Gene/Protein Resources |
GenBank Accession: | NM_000089.3 |
| Cytogenic location: | 7q21.3 |
| Chromosomal coordinates: | 7:94,023,872-94,060,543 |
| UniProt ID: | P08123 |
| HUGO ID: | 2198 |
|
Reference SNp(RefSNP): | rs1800222 |
| Disease/Mutation information |
Target Mutation: | c.246T>C,NP_000080.2:p.Asp82=
|
|
Mutation at gene level: | NG_007405.1:g.12027T>C
|
|
Pathogenic status of mutation: | Disease causing
|
|
Disease: | Osteogenesis Imperfecta (OI) |
| Clinical Resources |
ClinVar ID: | NA |
|
KEGG disease ID: | H00506 |
|
OMIM ID: | 166210 |
|
COSMIC: | COL1A2 |
|
DECIPHER: | COL1A2 |
|
GeneTests: | COL1A2 |
| ASP siRNA details |
Mutant allele (5'->3'): | UUUGCUGCUCAGUAUGAC
|
|
ASP-siRNA (As strand 3'->5'): | AAACGACGAGUCAUACUG
|
|
Percentage efficacy of ASP-siRNA for mutant allele: | 83
|
|
Wild allele (5'->3'): | UUUGCUGCUCAGUAUGAU
|
|
ASP-siRNA (As strand 3'->5'): | AAACGACGAGUCAUACUG
|
|
Percentage efficacy of ASP-siRNA for wild allele: | 100
|
|
Relative difference: | -17
|
| Wild siRNA details |
Wild allele (5'->3'): | UUUGCUGCUCAGUAUGAU
|
|
Wild siRNA (As strand 3'->5'): | AAACGACGAGUCAUACUA
|
|
Percentage efficacy of wild siRNA for wild allele: | NA
|
|
Wild allele (5'->3'): | UUUGCUGCUCAGUAUGAU
|
|
ASP-siRNA (As strand 3'->5'): | AAACGACGAGUCAUACUG
|
|
Percentage efficacy of Wild sirna for mutant allele: | NA
|
|
Relative difference : | NA
|
| General information |
Mismatch incorporated in siRNA/Target: | siRNA |
| Cell-line used: | Primary human bone |
| Experimental technique used: | RT-PCR |
| Transfection method: | Magnet asisted transfection (MATRA) |
| siRNA expression method: | Ambion |
| Post-transfection duration: | 48 hours |
| Concentration used: | 0.6microg |
| Reference: | 19015742 |
| Delivery method: | Transfection |
'| Article title: | Allele dependent silencing of COL1A2 using small interfering RNAs. |
'| Authors: | Lindahl K, Rubin CJ, Kindmark A, Ljunggren O. |
'| Journal Reference: | Int J Med Sci. 2008;5(6):361-5. Epub 2008 Nov 12. |
'
