| | |
| ASPsiRNA information |
siRNA Id: | aspsirna0556
|
|
siRNA Name: | MutA-si
|
| Mismatch information |
Wild siRNA (As strand 3'->5'): | GUCUCACCGACUCCUCUACUG
|
|
ASP-siRNA (As strand 3'->5'): | GUCUCACCGA---CUCUACUG
|
|
Mismatch position in siRNA: | DeltaGAG |
| Gene Information |
Gene Name | Torsin family 1, member A (TOR1A) |
|
Target Sequence (5'->3'): | GUAAGCAGAGUGGCUGAGGAGAUGACAUUUUUCCCCAAAGAG
|
|
Wild allele (5'->3'): | CAGAGUGGCUGAGGAGAUGAC
|
|
Mutant allele (5'->3'): | CAGAGUGGCU---GAGAUGAC
|
|
Position of siRNA on target gene: | 971-991
|
| Respective Gene/Protein Resources |
GenBank Accession: | NM_000113.2 |
| Cytogenic location: | 9q34.11 |
| Chromosomal coordinates: | 9:132,575,220-132,586,440 |
| UniProt ID: | O14656 |
| HUGO ID: | 3098 |
|
Reference SNp(RefSNP): | rs72415998 |
| Disease/Mutation information |
Target Mutation: | c.907_909delGAG,p.Glu303del
|
|
Matation type/variant: | Deletion
|
|
Mutation at gene level: | NG_008049.1:g.15099_15101delGAG
|
|
Pathogenic status of mutation: | Pathogenic
|
|
Disease: | DYT1 dystonia |
| Clinical Resources |
ClinVar ID: | 5180 |
|
KEGG disease ID: | H01255 |
|
OMIM ID: | 128100 |
|
COSMIC: | TOR1A |
|
DECIPHER: | TOR1A |
|
GeneTests: | TOR1A |
| ASP siRNA details |
Mutant allele (5'->3'): | CAGAGUGGCU---GAGAUGAC
|
|
ASP-siRNA (As strand 3'->5'): | GUCUCACCGA---CUCUACUG
|
|
Percentage efficacy of ASP-siRNA for mutant allele: | 80
|
|
Wild allele (5'->3'): | CAGAGUGGCUGAGGAGAUGAC
|
|
ASP-siRNA (As strand 3'->5'): | GUCUCACCGA---CUCUACUG
|
|
Percentage efficacy of ASP-siRNA for wild allele: | 45
|
|
Relative difference: | 35
|
| Wild siRNA details |
Wild allele (5'->3'): | CAGAGUGGCUGAGGAGAUGAC
|
|
Wild siRNA (As strand 3'->5'): | GUCUCACCGACUCCUCUACUG
|
|
Percentage efficacy of wild siRNA for wild allele: | 0
|
|
Wild allele (5'->3'): | CAGAGUGGCUGAGGAGAUGAC
|
|
ASP-siRNA (As strand 3'->5'): | GUCUCACCGA---CUCUACUG
|
|
Percentage efficacy of Wild sirna for mutant allele: | 82
|
|
Relative difference : | -82
|
| General information |
Mismatch incorporated in siRNA/Target: | siRNA |
| Cell-line used: | Cos-7 |
| Experimental technique used: | Western blot |
| Transfection method: | Lipofectamine Plus |
| siRNA expression method: | Epicentre Technologies |
| Post-transfection duration: | 36-48 hours |
| Concentration used: | 5microg |
| Reference: | 12783425 |
| Delivery method: | Transfection |
'| Article title: | Toward therapy for DYT1 dystonia: allele-specific silencing of mutant TorsinA |
'| Authors: | Gonzalez-Alegre P1, Miller VM, Davidson BL, Paulson HL |
'| Journal Reference: | Ann Neurol. 2003 Jun;53(6):781-7 |
'