| | |
ASPsiRNA information |
siRNA Id: | aspsirna0659
|
siRNA Name: | RM4
|
Mismatch information |
Wild siRNA (As strand 3'->5'): | GCUGCUGCUGCUGCUGCUG
|
ASP-siRNA (As strand 3'->5'): | UUGUCAUCGUUGUCGACG
|
Mismatch position in siRNA: | A3U,U8C,A13G |
Gene Information |
Gene Name | Hungtintin (HTT) |
Target Sequence (5'->3'): | CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC
|
Wild allele (5'->3'): | CGACGACGACGACGACGAC
|
Mutant allele (5'->3'): | AACAGUAGCAACAGCUGC
|
Position of siRNA on target gene: | NA
|
Respective Gene/Protein Resources |
GenBank Accession: | NM_002111.7 |
Cytogenic location: | 4p16.3 |
Chromosomal coordinates: | 4:3,076,407-3,245,686 |
UniProt ID: | Q96CV9 |
HUGO ID: | 4851 |
Reference SNp(RefSNP): | rs19392295 |
Disease/Mutation information |
Target Mutation: | c.52CAG(36_39)
|
Matation type/variant: | Microsatellite
|
Mutation at gene level: | NG_009378.1:g.5197CAG(36_39)
|
Pathogenic status of mutation: | Pathogenic
|
Disease: | Huntington disease (HD) |
Clinical Resources |
ClinVar ID: | 31916 |
KEGG disease ID: | H01243 |
OMIM ID: | 143100 |
COSMIC: | HTT |
DECIPHER: | HTT |
GeneTests: | HTT |
ASP siRNA details |
Mutant allele (5'->3'): | AACAGUAGCAACAGCUGC
|
ASP-siRNA (As strand 3'->5'): | UUGUCAUCGUUGUCGACG
|
Percentage efficacy of ASP-siRNA for mutant allele: | 20
|
Wild allele (5'->3'): | CGACGACGACGACGACGAC
|
ASP-siRNA (As strand 3'->5'): | UUGUCAUCGUUGUCGACG
|
Percentage efficacy of ASP-siRNA for wild allele: | 15
|
Relative difference: | 5
|
Wild siRNA details |
Wild allele (5'->3'): | CGACGACGACGACGACGAC
|
Wild siRNA (As strand 3'->5'): | GCUGCUGCUGCUGCUGCUG
|
Percentage efficacy of wild siRNA for wild allele: | Lowest effective
|
Wild allele (5'->3'): | CGACGACGACGACGACGAC
|
ASP-siRNA (As strand 3'->5'): | UUGUCAUCGUUGUCGACG
|
Percentage efficacy of Wild sirna for mutant allele: | 65
|
Relative difference : | discriminative
|
General information |
Mismatch incorporated in siRNA/Target: | siRNA |
Cell-line used: | Fibroblast |
Experimental technique used: | Western blot |
Transfection method: | RNAiMAX |
siRNA expression method: | Integrated DNA Technologies |
Post-transfection duration: | 72 hours |
Concentration used: | 50nM |
Reference: | 23042244 |
Delivery method: | Transfection |
'Article title: | Mechanism of allele-selective inhibition of huntingtin expression by duplex RNAs that target CAG repeats: function through the RNAi pathway. |
'Authors: | Hu J, Liu J, Yu D, Chu Y, Corey DR. |
'Journal Reference: | Nucleic Acids Res. 2012 Dec;40(22):11270-80. doi: 10.1093/nar/gks907. Epub 2012 Oct 4. |
'