| | |
ASPsiRNA information |
siRNA Id: | aspsirna0919
|
siRNA Name: | Sibeta2m04
|
Mismatch information |
Wild siRNA (As strand 3'->5'): | AAGCUUCGAACUUCCAUU
|
ASP-siRNA (As strand 3'->5'): | AAGCUUCGAACUUCGAUU
|
Mismatch position in siRNA: | G4C |
Gene Information |
Gene Name | Beta 2-microglobulin (B2M) |
Target Sequence (5'->3'): | ATTGAAAAAGTGGAGCATTCAGACT
|
Wild allele (5'->3'): | UUCGAAGCUUGAAGGUAA
|
Mutant allele (5'->3'): | UUCGAAGCUUGAAGCUAA
|
Position of siRNA on target gene: | NA
|
Respective Gene/Protein Resources |
GenBank Accession: | NM_004048.2 |
Cytogenic location: | 15q21.1 |
Chromosomal coordinates: | 15:45,003,684-45,010,356 |
UniProt ID: | P61769 |
HUGO ID: | 914 |
Reference SNp(RefSNP): | rs10489448 |
Disease/Mutation information |
Target Mutation: | c.31G>C,p.Ala11Pro
|
Matation type/variant: | Single nucleotide variant/Missense variant
|
Mutation at gene level: | NG_012920.1:g.5091G>C
|
Pathogenic status of mutation: | Pathogenic
|
Disease: | HLA incompatibility |
Clinical Resources |
ClinVar ID: | 17740 |
KEGG disease ID: | NA |
OMIM ID: | NA |
COSMIC: | B2M |
DECIPHER: | B2M |
GeneTests: | B2M |
ASP siRNA details |
Mutant allele (5'->3'): | UUCGAAGCUUGAAGCUAA
|
ASP-siRNA (As strand 3'->5'): | AAGCUUCGAACUUCGAUU
|
Percentage efficacy of ASP-siRNA for mutant allele: | 88
|
Wild allele (5'->3'): | UUCGAAGCUUGAAGGUAA
|
ASP-siRNA (As strand 3'->5'): | AAGCUUCGAACUUCGAUU
|
Percentage efficacy of ASP-siRNA for wild allele: | NA
|
Relative difference: | NA
|
Wild siRNA details |
Wild allele (5'->3'): | UUCGAAGCUUGAAGGUAA
|
Wild siRNA (As strand 3'->5'): | AAGCUUCGAACUUCCAUU
|
Percentage efficacy of wild siRNA for wild allele: | 50
|
Wild allele (5'->3'): | UUCGAAGCUUGAAGGUAA
|
ASP-siRNA (As strand 3'->5'): | AAGCUUCGAACUUCGAUU
|
Percentage efficacy of Wild sirna for mutant allele: | 90
|
Relative difference : | -40
|
General information |
Mismatch incorporated in siRNA/Target: | siRNA
|
Cell-line used: | HeLa |
Experimental technique used: | Western blot |
Transfection method: | RNAiFect |
siRNA expression method: | Ambion |
Post-transfection duration: | 48 hours |
Concentration used: | 1.2mIcrog |
Reference: | 16520945 |
Delivery method: | Lentiviral vector delivery |
Article title: | Class-, gene-, and group-specific HLA silencing by lentiviral shRNA delivery. |
Authors: | Figueiredo C, Seltsam A, Blasczyk R. |
Journal Reference: | J Mol Med (Berl). 2006 May;84(5):425-37. Epub 2006 Mar 7. |