| | |
ASPsiRNA information |
siRNA Id: | aspsirna0923
|
siRNA Name: | U6TAmut1
|
Mismatch information |
Wild siRNA (As strand 3'->5'): | CUCACCGACUCCUCUACUGUAA
|
ASP-siRNA (As strand 3'->5'): | CUCACCGACUC---UACUGUAA
|
Mismatch position in siRNA: | NA |
Gene Information |
Gene Name | Torsin family 1, member A (TOR1A) |
Target Sequence (5'->3'): | AAGCAGAGTGGCTGAGGAGATGACATTTTTCCCCAAA
|
Wild allele (5'->3'): | GAGUGGCUGAGGAGAUGACAUU
|
Mutant allele (5'->3'): | GAGUGGCUGAG---AUGACAUU
|
Position of siRNA on target gene: | 973-994
|
Respective Gene/Protein Resources |
GenBank Accession: | NM_000113.2 |
Cytogenic location: | 9q34.11 |
Chromosomal coordinates: | 9:132,575,220-132,586,440 |
UniProt ID: | O14656 |
HUGO ID: | 3098 |
Reference SNp(RefSNP): | rs72415998 |
Disease/Mutation information |
Target Mutation: | c.907_909delGAG,p.Glu303del
|
Matation type/variant: | Deletion/inframe variant
|
Mutation at gene level: | NG_008049.1:g.15099_15101delGAG
|
Pathogenic status of mutation: | Pathogenic
|
Disease: | Early onset torsion dystonia (DYT1) |
Clinical Resources |
ClinVar ID: | 5180 |
KEGG disease ID: | H01255 |
OMIM ID: | 128100 |
COSMIC: | TOR1A |
DECIPHER: | TOR1A |
GeneTests: | TOR1A |
ASP siRNA details |
Mutant allele (5'->3'): | GAGUGGCUGAG---AUGACAUU
|
ASP-siRNA (As strand 3'->5'): | CUCACCGACUC---UACUGUAA
|
Percentage efficacy of ASP-siRNA for mutant allele: | 92
|
Wild allele (5'->3'): | GAGUGGCUGAGGAGAUGACAUU
|
ASP-siRNA (As strand 3'->5'): | CUCACCGACUC---UACUGUAA
|
Percentage efficacy of ASP-siRNA for wild allele: | 58
|
Relative difference: | 34
|
Wild siRNA details |
Wild allele (5'->3'): | GAGUGGCUGAGGAGAUGACAUU
|
Wild siRNA (As strand 3'->5'): | CUCACCGACUCCUCUACUGUAA
|
Percentage efficacy of wild siRNA for wild allele: | 40
|
Wild allele (5'->3'): | GAGUGGCUGAGGAGAUGACAUU
|
ASP-siRNA (As strand 3'->5'): | CUCACCGACUC---UACUGUAA
|
Percentage efficacy of Wild sirna for mutant allele: | 12
|
Relative difference : | 28
|
General information |
Mismatch incorporated in siRNA/Target: | siRNA
|
Cell-line used: | Cos-7 |
Experimental technique used: | Western blot |
Transfection method: | Lipofectamine Plus |
siRNA expression method: | Chemically synthesized |
Post-transfection duration: | 48 hours |
Concentration used: | 100nM |
Reference: | 16280588 |
Delivery method: | Transfection |
Article title: | Silencing primary dystonia: lentiviral-mediated RNA interference therapy for DYT1 dystonia |
Authors: | Gonzalez-Alegre P, Bode N, Davidson BL, Paulson HL |
Journal Reference: | J Neurosci. 2005 Nov 9;25(45):10502-9 |