| | |
|---|
| ASPsiRNA information |
siRNA Id: | aspsirna1017
|
|
siRNA Name: | siRNAC
|
| Mismatch information |
Wild siRNA (As strand 3'->5'): | GGCGUUUUCGGUUUUUUA
|
|
ASP-siRNA (As strand 3'->5'): | GGGGUUUUCGGUUUUUUA
|
|
Mismatch position in siRNA: | G17C |
| Gene Information |
Gene Name | Collagen type I alpha 1 (COL1A1) |
|
Target Sequence (5'->3'): | CCCCCCAAAAGCCAAAAAATG
|
|
Wild allele (5'->3'): | CCGCAAAAGCCAAAAAAU
|
|
Mutant allele (5'->3'): | CCCCAAAAGCCAAAAAAU
|
|
Position of siRNA on target gene: | NA
|
| Respective Gene/Protein Resources |
GenBank Accession: | NM_000088.3 |
| Cytogenic location: | 17q21.33 |
| Chromosomal coordinates: | 17:48,261,456-48,279,002 |
| UniProt ID: | P02452 |
| HUGO ID: | 2197 |
|
Reference SNp(RefSNP): | rs1061237 |
| Disease/Mutation information |
Target Mutation: | c.*88T>C
|
|
Matation type/variant: | Single nucleotide variant/Missense variant
|
|
Mutation at gene level: | NG_007400.1:g.21226T>C
|
|
Pathogenic status of mutation: | Pathogenic
|
|
Disease: | Osteogenesis Imperfecta (OI) |
| Clinical Resources |
ClinVar ID: | NA |
|
KEGG disease ID: | H00506 |
|
OMIM ID: | 166210 |
|
COSMIC: | COL1A1 |
|
DECIPHER: | COL1A1 |
|
GeneTests: | COL1A1 |
| ASP siRNA details |
Mutant allele (5'->3'): | CCCCAAAAGCCAAAAAAU
|
|
ASP-siRNA (As strand 3'->5'): | GGGGUUUUCGGUUUUUUA
|
|
Percentage efficacy of ASP-siRNA for mutant allele: | 80
|
|
Wild allele (5'->3'): | CCGCAAAAGCCAAAAAAU
|
|
ASP-siRNA (As strand 3'->5'): | GGGGUUUUCGGUUUUUUA
|
|
Percentage efficacy of ASP-siRNA for wild allele: | 40
|
|
Relative difference: | 40
|
| Wild siRNA details |
Wild allele (5'->3'): | CCGCAAAAGCCAAAAAAU
|
|
Wild siRNA (As strand 3'->5'): | GGCGUUUUCGGUUUUUUA
|
|
Percentage efficacy of wild siRNA for wild allele: | NA
|
|
Wild allele (5'->3'): | CCGCAAAAGCCAAAAAAU
|
|
ASP-siRNA (As strand 3'->5'): | GGGGUUUUCGGUUUUUUA
|
|
Percentage efficacy of Wild sirna for mutant allele: | NA
|
|
Relative difference : | NA
|
| General information |
Mismatch incorporated in siRNA/Target: | siRNA |
| Cell-line used: | Mesenchymal progenitor Stem cells(MPCs) |
| Experimental technique used: | ELISA assay |
| Transfection method: | Lipofectamine 2000 |
| siRNA expression method: | Qiagen |
| Post-transfection duration: | 24 hours |
| Concentration used: | 50nMol |
| Reference: | 15241481 |
| Delivery method: | Transfection |
'| Article title: | RNAi of COL1A1 in mesenchymal progenitor cells. |
'| Authors: | Millington-Ward S, McMahon HP, Allen D, Tuohy G, Kiang AS, Palfi A, Kenna PF, Humphries P, Farrar GJ. |
'| Journal Reference: | Eur J Hum Genet. 2004 Oct;12(10):864-6 |
'
