| | |
| ASPsiRNA information |
siRNA Id: | aspsirna1025
|
|
siRNA Name: | R4 siRNA
|
| Mismatch information |
Wild siRNA (As strand 3'->5'): | CUCUGAACCCGUUACACUG?
|
|
ASP-siRNA (As strand 3'->5'): | CUCUGAACCCGUUACACUG?
|
|
Mismatch position in siRNA: | A16U(S) |
| Gene Information |
Gene Name | Cu,Zn superoxide dismutase (SOD1) |
|
Target Sequence (5'->3'): | AGGCATGTTGGAGACTTGGGCAATGTGACTGCTGACAAA
|
|
Wild allele (5'->3'): | GAGACUUGGGCAAUGUGAC
|
|
Mutant allele (5'->3'): | GAGACUUGGGCAAUGAGAC
|
|
Position of siRNA on target gene: | 396-414
|
| Respective Gene/Protein Resources |
GenBank Accession: | NM_000454.4 |
| Cytogenic location: | 21q22.11 |
| Chromosomal coordinates: | 21:33,031,934-33,041,243 |
| UniProt ID: | P00441 |
| HUGO ID: | 11179 |
|
Reference SNp(RefSNP): | rs12191243 |
| Disease/Mutation information |
Target Mutation: | c.256G>C,p.Gly86Arg
|
|
Matation type/variant: | Single nucleotide variant/Missense variant
|
|
Mutation at gene level: | NG_008689.1:g.12653G>C
|
|
Pathogenic status of mutation: | Pathogenic
|
|
Disease: | Amyotrophic Lateral Sclerosis (ALS) |
| Clinical Resources |
ClinVar ID: | 14758 |
|
KEGG disease ID: | H00058 |
|
OMIM ID: | 105400 |
|
COSMIC: | SOD1 |
|
DECIPHER: | SOD1 |
|
GeneTests: | SOD1 |
| ASP siRNA details |
Mutant allele (5'->3'): | GAGACUUGGGCAAUGAGAC
|
|
ASP-siRNA (As strand 3'->5'): | CUCUGAACCCGUUACACUG?
|
|
Percentage efficacy of ASP-siRNA for mutant allele: | 90
|
|
Wild allele (5'->3'): | GAGACUUGGGCAAUGUGAC
|
|
ASP-siRNA (As strand 3'->5'): | CUCUGAACCCGUUACACUG?
|
|
Percentage efficacy of ASP-siRNA for wild allele: | 3
|
|
Relative difference: | 87
|
| Wild siRNA details |
Wild allele (5'->3'): | GAGACUUGGGCAAUGUGAC
|
|
Wild siRNA (As strand 3'->5'): | CUCUGAACCCGUUACACUG?
|
|
Percentage efficacy of wild siRNA for wild allele: | 8
|
|
Wild allele (5'->3'): | GAGACUUGGGCAAUGUGAC
|
|
ASP-siRNA (As strand 3'->5'): | CUCUGAACCCGUUACACUG?
|
|
Percentage efficacy of Wild sirna for mutant allele: | 80
|
|
Relative difference : | 72
|
| General information |
Mismatch incorporated in siRNA/Target: | siRNA |
| Cell-line used: | HEK293 |
| Experimental technique used: | Dual luciferase reporter assay |
| Transfection method: | Lipofectamine 2000 |
| siRNA expression method: | Dharmacon |
| Post-transfection duration: | 24 hours |
| Concentration used: | 2.0microg/mL |
| Reference: | 18215350 |
| Delivery method: | Transfection |
'| Article title: | Double-mismatched siRNAs enhance selective gene silencing of a mutant ALS-causing allele. |
'| Authors: | Geng CM, Ding HL. |
'| Journal Reference: | Acta Pharmacol Sin. 2008 Feb;29(2):211-6. doi: 10.1111/j.1745-7254.2008.00740.x. |
'