| | |
ASPsiRNA information |
siRNA Id: | aspsirna1214
|
siRNA Name: | siCD46-12A
|
Mismatch information |
Wild siRNA (As strand 3'->5'): | GAAUAACCUCUCUCGUGCU
|
ASP-siRNA (As strand 3'->5'): | GAAUAACAUCUCUCGUGC
|
Mismatch position in siRNA: | 12A,0.44 |
Gene Information |
Gene Name | Complement regulatory protein (CD46) |
Target Sequence (5'->3'): | CTTATTGGAGAGAGCACGATTTATTGTGGTGACA
|
Wild allele (5'->3'): | CUUAUUGGAGAGAGCACGA
|
Mutant allele (5'->3'): | CUUAUUGUAGAGAGCACG
|
Position of siRNA on target gene: | 779-797
|
Respective Gene/Protein Resources |
GenBank Accession: | NM_002389.4 |
Cytogenic location: | 1q32.2 |
Chromosomal coordinates: | 1:207,925,382-207,968,860 |
UniProt ID: | P15529 |
HUGO ID: | 6953 |
Reference SNp(RefSNP): | rs12190959 |
Disease/Mutation information |
Target Mutation: | NM_002389.4:c.104G>A, p.Cys35Tyr
|
Matation type/variant: | single nucleotide variant/Missense variant
|
Mutation at gene level: | NG_009296.1:g.9964G>A
|
Pathogenic status of mutation: | Risk factor
|
Disease: | Hemolytic uremic syndrome |
Clinical Resources |
ClinVar ID: | 17049 |
KEGG disease ID: | H00106, H0027 |
OMIM ID: | 120920 |
COSMIC: | CD46 |
DECIPHER: | CD46 |
GeneTests: | CD46 |
ASP siRNA details |
Mutant allele (5'->3'): | CUUAUUGUAGAGAGCACG
|
ASP-siRNA (As strand 3'->5'): | GAAUAACAUCUCUCGUGC
|
Percentage efficacy of ASP-siRNA for mutant allele: | 88
|
Wild allele (5'->3'): | CUUAUUGGAGAGAGCACGA
|
ASP-siRNA (As strand 3'->5'): | GAAUAACAUCUCUCGUGC
|
Percentage efficacy of ASP-siRNA for wild allele: | 43
|
Relative difference: | 45
|
Wild siRNA details |
Wild allele (5'->3'): | CUUAUUGGAGAGAGCACGA
|
Wild siRNA (As strand 3'->5'): | GAAUAACCUCUCUCGUGCU
|
Percentage efficacy of wild siRNA for wild allele: | NA
|
Wild allele (5'->3'): | CUUAUUGGAGAGAGCACGA
|
ASP-siRNA (As strand 3'->5'): | GAAUAACAUCUCUCGUGC
|
Percentage efficacy of Wild sirna for mutant allele: | 38
|
Relative difference : | NA
|
General information |
Mismatch incorporated in siRNA/Target: | Target gene |
Cell-line used: | HEK293 |
Experimental technique used: | Dual luciferase reporter assay |
Transfection method: | Lipofectamine 2000 |
siRNA expression method: | Invitrogen |
Post-transfection duration: | 24 hours |
Concentration used: | 13nM |
Reference: | 18420656 |
Delivery method: | Transfection |
'Article title: | Analysis of siRNA specificity on targets with double-nucleotide mismatches. |
'Authors: | Dahlgren C, Zhang HY, Du Q, Grahn M, Norstedt G, Wahlestedt C, Liang Z. |
'Journal Reference: | Nucleic Acids Res. 2008 May;36(9):e53. doi: 10.1093/nar/gkn190. Epub 2008 Apr 17. |
'