| ASPsiRNA information | siRNA Id: | aspsirna1788 |
| siRNA Name: | si10TM9 | |
| Mismatch information | Wild siRNA (As strand 3'->5'): | CGACGCGAUGGCGCUUCUG |
| ASP-siRNA (As strand 3'->5'): | CGACGCGAUAACGCUUCUG | |
| Mismatch position in siRNA: | A10G,A9G | |
| Gene Information | Gene Name | Polymerase (RNA) II (DNA directed) polypeptide A (POLR2A) |
| Target Sequence (5'->3'): | TTCCACGCCATGGGGGGTCGTGAGGGGCTCATTGACA | |
| Wild allele (5'->3'): | GCUGCGCUACCGCGAAGAC | |
| Mutant allele (5'->3'): | GCUGCGCUAUUGCGAAGAC | |
| Position of siRNA on target gene: | 2898-2934 | |
| Respective Gene/Protein Resources | GenBank Accession: | NM_000937.4 |
| Cytogenic location: | 17p13.1 | |
| Chromosomal coordinates: | 17:7,387,697-7,417,934 | |
| UniProt ID: | P24928 | |
| HUGO ID: | 9187 | |
| Reference SNp(RefSNP): | rs14801110 | |
| Disease/Mutation information | Target Mutation: | c.2907C>T,(p.Ile969=) |
| Matation type/variant: | single nucleotide variant/synonymous variant | |
| Mutation at gene level: | NG_027747.1:g.23893C>T | |
| Pathogenic status of mutation: | Not provided | |
| Disease: | Cancer | |
| Clinical Resources | ClinVar ID: | 80702 |
| KEGG disease ID: | H00014 | |
| OMIM ID: | 180660 | |
| COSMIC: | POLR2A | |
| DECIPHER: | POLR2A | |
| GeneTests: | POLR2A | |
| ASP siRNA details | Mutant allele (5'->3'): | GCUGCGCUAUUGCGAAGAC |
| ASP-siRNA (As strand 3'->5'): | CGACGCGAUAACGCUUCUG | |
| Percentage efficacy of ASP-siRNA for mutant allele: | NA | |
| Wild allele (5'->3'): | GCUGCGCUACCGCGAAGAC | |
| ASP-siRNA (As strand 3'->5'): | CGACGCGAUAACGCUUCUG | |
| Percentage efficacy of ASP-siRNA for wild allele: | 34 | |
| Relative difference: | NA | |
| Wild siRNA details | Wild allele (5'->3'): | GCUGCGCUACCGCGAAGAC |
| Wild siRNA (As strand 3'->5'): | CGACGCGAUGGCGCUUCUG | |
| Percentage efficacy of wild siRNA for wild allele: | 20 | |
| Wild allele (5'->3'): | GCUGCGCUACCGCGAAGAC | |
| ASP-siRNA (As strand 3'->5'): | CGACGCGAUAACGCUUCUG | |
| Percentage efficacy of Wild sirna for mutant allele: | NA | |
| Relative difference : | NA | |
| General information | Mismatch incorporated in siRNA/Target: | siRNA |
| Cell-line used: | 15PC3 | |
| Experimental technique used: | Northern blot | |
| Transfection method: | Lipofectamine 2000 | |
| siRNA expression method: | Proligo | |
| Post-transfection duration: | 24 hours | |
| Concentration used: | 100nM | |
| Reference: | 19165236 | |
| Delivery method: | Transfection | |
| Article title: | Allele-specific cancer cell killing in vitro and in vivo targeting a single-nucleotide polymorphism in POLR2A. | |
| Authors: | Mook OR, Baas F, de Wissel MB, Fluiter K. | |
| Journal Reference: | Cancer Gene Ther. 2009 Jun;16(6):532-8. doi: 10.1038/cgt.2008.104. Epub 2009 Jan 23. |
| ASPsiRNA information | siRNA Id: | aspsirna1788 |
| siRNA Name: | siCD46 | |
| Mismatch information | Wild siRNA (As strand 3'->5'): | GAAUAACCUCUCUCGUGCU |
| ASP-siRNA (As strand 3'->5'): | GAAUAACCUCUCUCGUGCU | |
| Mismatch position in siRNA: | A:C clash | |
| Gene Information | Gene Name | Complement regulatory protein (CD46) |
| Target Sequence (5'->3'): | GCCCCCAATATGTGAAAAG | |
| Wild allele (5'->3'): | CUUAUUGGAGAGAGCACGA | |
| Mutant allele (5'->3'): | CUCAUUGGAGAGAGCACGA | |
| Position of siRNA on target gene: | 779-797 | |
| Respective Gene/Protein Resources | GenBank Accession: | NM_002389.4 |
| Cytogenic location: | 1q32.2 | |
| Chromosomal coordinates: | 1:207,925,382-207,968,860 | |
| UniProt ID: | P15529 | |
| HUGO ID: | 6953 | |
| Reference SNp(RefSNP): | rs12190959 | |
| Disease/Mutation information | Target Mutation: | c.104G>A, p.Cys35Tyr |
| Matation type/variant: | single nucleotide variant/Missense variant | |
| Mutation at gene level: | NG_009296.1:g.9964G>A | |
| Pathogenic status of mutation: | Risk factor | |
| Disease: | Hemolytic uremic syndrome | |
| Clinical Resources | ClinVar ID: | 17049 |
| KEGG disease ID: | H00106, H0027 | |
| OMIM ID: | 120920 | |
| COSMIC: | CD46 | |
| DECIPHER: | CD46 | |
| GeneTests: | CD46 | |
| ASP siRNA details | Mutant allele (5'->3'): | CUCAUUGGAGAGAGCACGA |
| ASP-siRNA (As strand 3'->5'): | GAAUAACCUCUCUCGUGCU | |
| Percentage efficacy of ASP-siRNA for mutant allele: | 80 | |
| Wild allele (5'->3'): | CUUAUUGGAGAGAGCACGA | |
| ASP-siRNA (As strand 3'->5'): | GAAUAACCUCUCUCGUGCU | |
| Percentage efficacy of ASP-siRNA for wild allele: | 93 | |
| Relative difference: | 13 | |
| Wild siRNA details | Wild allele (5'->3'): | CUUAUUGGAGAGAGCACGA |
| Wild siRNA (As strand 3'->5'): | GAAUAACCUCUCUCGUGCU | |
| Percentage efficacy of wild siRNA for wild allele: | 93 | |
| Wild allele (5'->3'): | CUUAUUGGAGAGAGCACGA | |
| ASP-siRNA (As strand 3'->5'): | GAAUAACCUCUCUCGUGCU | |
| Percentage efficacy of Wild sirna for mutant allele: | 80 | |
| Relative difference : | 13 | |
| General information | Mismatch incorporated in siRNA/Target: | siRNA |
| Cell-line used: | HEK293 | |
| Experimental technique used: | Dual luciferase reporter assay | |
| Transfection method: | Lipofectamine 2000 | |
| siRNA expression method: | Dharmacon | |
| Post-transfection duration: | 24 hours | |
| Concentration used: | 13nM | |
| Reference: | 15781493 | |
| Delivery method: | Transfection | |
| Article title: | A systematic analysis of the silencing effects of an active siRNA at all single-nucleotide mismatched target sites. | |
| Authors: | Du Q, Thonberg H, Wang J, Wahlestedt C, Liang Z. | |
| Journal Reference: | Nucleic Acids Res. 2005 Mar 21;33(5):1671-7. Print 2005. Erratum in: Nucleic Acids Res. 2005;33(11):3698. |