| ASPsiRNA information | siRNA Id: | aspsirna1793 |
| siRNA Name: | TTR-p11 | |
| Mismatch information | Wild siRNA (As strand 3'->5'): | GUUACACCGGCACGUACAC |
| ASP-siRNA (As strand 3'->5'): | GUUACACCGGUACGUACAC | |
| Mismatch position in siRNA: | U9C | |
| Gene Information | Gene Name | Transthyretin (TTR) |
| Target Sequence (5'->3'): | GCCAUCAAUGUGGCCAUGCAUGUGUUCAGAAAG | |
| Wild allele (5'->3'): | CAAUGUGGCCGUGCAUGUG | |
| Mutant allele (5'->3'): | CAAUGUGGCCAUGCAUGUG | |
| Position of siRNA on target gene: | 274-292 | |
| Respective Gene/Protein Resources | GenBank Accession: | NM_000371.3 |
| Cytogenic location: | 18q12.1 | |
| Chromosomal coordinates: | 18:29,171,729-29,178,986 | |
| UniProt ID: | P02766 | |
| HUGO ID: | 12405 | |
| Reference SNp(RefSNP): | rs28933979 | |
| Disease/Mutation information | Target Mutation: | c.148G>A,p.Val50Met |
| Matation type/variant: | Single nucleotide variant/missense variant | |
| Mutation at gene level: | NG_009490.1:g.6208G>A | |
| Pathogenic status of mutation: | Pathogenic | |
| Disease: | Amyloidogenic transthyretin amyloidosis | |
| Clinical Resources | ClinVar ID: | 13417 |
| KEGG disease ID: | 105210 | |
| OMIM ID: | 176300 | |
| COSMIC: | TTR | |
| DECIPHER: | TTR | |
| GeneTests: | TTR | |
| ASP siRNA details | Mutant allele (5'->3'): | CAAUGUGGCCAUGCAUGUG |
| ASP-siRNA (As strand 3'->5'): | GUUACACCGGUACGUACAC | |
| Percentage efficacy of ASP-siRNA for mutant allele: | NA | |
| Wild allele (5'->3'): | CAAUGUGGCCGUGCAUGUG | |
| ASP-siRNA (As strand 3'->5'): | GUUACACCGGUACGUACAC | |
| Percentage efficacy of ASP-siRNA for wild allele: | 65 | |
| Relative difference: | NA | |
| Wild siRNA details | Wild allele (5'->3'): | CAAUGUGGCCGUGCAUGUG |
| Wild siRNA (As strand 3'->5'): | GUUACACCGGCACGUACAC | |
| Percentage efficacy of wild siRNA for wild allele: | 67 | |
| Wild allele (5'->3'): | CAAUGUGGCCGUGCAUGUG | |
| ASP-siRNA (As strand 3'->5'): | GUUACACCGGUACGUACAC | |
| Percentage efficacy of Wild sirna for mutant allele: | NA | |
| Relative difference : | NA | |
| General information | Mismatch incorporated in siRNA/Target: | siRNA |
| Cell-line used: | Cos-7 | |
| Experimental technique used: | Western blot | |
| Transfection method: | Lipofectamine 2000 | |
| siRNA expression method: | Qiagen | |
| Post-transfection duration: | 48 hours | |
| Concentration used: | 20pMol | |
| Reference: | 16225852 | |
| Delivery method: | Transfection | |
| Article title: | Selective silencing of a mutant transthyretin allele by small interfering RNAs | |
| Authors: | Kurosawa T, Igarashi S, Nishizawa M, Onodera O | |
| Journal Reference: | Biochem Biophys Res Commun. 2005 Nov 25;337(3):1012-8. Epub 2005 Oct 3 |
| ASPsiRNA information | siRNA Id: | aspsirna1793 |
| siRNA Name: | siCD46 | |
| Mismatch information | Wild siRNA (As strand 3'->5'): | NA |
| ASP-siRNA (As strand 3'->5'): | GAAUAACCUCUCUCGUGCU | |
| Mismatch position in siRNA: | A:U pair | |
| Gene Information | Gene Name | Complement regulatory protein (CD46) |
| Target Sequence (5'->3'): | GCCCCCAATATGTGAAAAG | |
| Wild allele (5'->3'): | NA | |
| Mutant allele (5'->3'): | CUUAUUGGAGAGAGCACGA | |
| Position of siRNA on target gene: | 779-797 | |
| Respective Gene/Protein Resources | GenBank Accession: | NM_002389.4 |
| Cytogenic location: | 1q32.2 | |
| Chromosomal coordinates: | 1:207,925,382-207,968,860 | |
| UniProt ID: | P15529 | |
| HUGO ID: | 6953 | |
| Reference SNp(RefSNP): | rs12190959 | |
| Disease/Mutation information | Target Mutation: | c.104G>A, p.Cys35Tyr |
| Matation type/variant: | single nucleotide variant/Missense variant | |
| Mutation at gene level: | NG_009296.1:g.9964G>A | |
| Pathogenic status of mutation: | Risk factor | |
| Disease: | Hemolytic uremic syndrome | |
| Clinical Resources | ClinVar ID: | 17049 |
| KEGG disease ID: | H00106, H0027 | |
| OMIM ID: | 120920 | |
| COSMIC: | CD46 | |
| DECIPHER: | CD46 | |
| GeneTests: | CD46 | |
| ASP siRNA details | Mutant allele (5'->3'): | CUUAUUGGAGAGAGCACGA |
| ASP-siRNA (As strand 3'->5'): | GAAUAACCUCUCUCGUGCU | |
| Percentage efficacy of ASP-siRNA for mutant allele: | 93 | |
| Wild allele (5'->3'): | NA | |
| ASP-siRNA (As strand 3'->5'): | GAAUAACCUCUCUCGUGCU | |
| Percentage efficacy of ASP-siRNA for wild allele: | NA | |
| Relative difference: | NA | |
| Wild siRNA details | Wild allele (5'->3'): | NA |
| Wild siRNA (As strand 3'->5'): | NA | |
| Percentage efficacy of wild siRNA for wild allele: | NA | |
| Wild allele (5'->3'): | NA | |
| ASP-siRNA (As strand 3'->5'): | GAAUAACCUCUCUCGUGCU | |
| Percentage efficacy of Wild sirna for mutant allele: | 93 | |
| Relative difference : | NA | |
| General information | Mismatch incorporated in siRNA/Target: | siRNA |
| Cell-line used: | HEK293 | |
| Experimental technique used: | Dual luciferase reporter assay | |
| Transfection method: | Lipofectamine 2000 | |
| siRNA expression method: | Dharmacon | |
| Post-transfection duration: | 24 hours | |
| Concentration used: | 13nM | |
| Reference: | 15781493 | |
| Delivery method: | Transfection | |
| Article title: | A systematic analysis of the silencing effects of an active siRNA at all single-nucleotide mismatched target sites. | |
| Authors: | Du Q, Thonberg H, Wang J, Wahlestedt C, Liang Z. | |
| Journal Reference: | Nucleic Acids Res. 2005 Mar 21;33(5):1671-7. Print 2005. Erratum in: Nucleic Acids Res. 2005;33(11):3698. |