ASPsiRNA information | siRNA Id: | aspsirna1796 |
siRNA Name: | M2 | |
Mismatch information | Wild siRNA (As strand 3'->5'): | UCUAGUUCUGGGAGUUGUU |
ASP-siRNA (As strand 3'->5'): | UCUAGUUCUGGGAGUUUUU | |
Mismatch position in siRNA: | U3G | |
Gene Information | Gene Name | keratin 6a (KRT6a) |
Target Sequence (5'->3'): | AGCGUGAACAGAUCAAGACCCUCAACAACAAGUUUGCCUCCUUCA | |
Wild allele (5'->3'): | AGAUCAAGACCCUCAACAA | |
Mutant allele (5'->3'): | AGAUCAAGACCCUCAAAAA | |
Position of siRNA on target gene: | 497-515 | |
Respective Gene/Protein Resources | GenBank Accession: | NM_005554.3 |
Cytogenic location: | 12q13.1 | |
Chromosomal coordinates: | 12:52,880,957-52,887,180 | |
UniProt ID: | P02538 | |
HUGO ID: | 6443 | |
Reference SNp(RefSNP): | rs59685571 | |
Disease/Mutation information | Target Mutation: | c.513C>A,p.Asn171Lys |
Matation type/variant: | Deletion | |
Mutation at gene level: | NG_008298.1:g.5722C>A | |
Pathogenic status of mutation: | Pathogenic | |
Disease: | Pachyonychia congenita (PC) | |
Clinical Resources | ClinVar ID: | 66589 |
KEGG disease ID: | H00684 | |
OMIM ID: | 167200 | |
COSMIC: | KRT6a | |
DECIPHER: | KRT6a | |
GeneTests: | KRT6a | |
ASP siRNA details | Mutant allele (5'->3'): | AGAUCAAGACCCUCAAAAA |
ASP-siRNA (As strand 3'->5'): | UCUAGUUCUGGGAGUUUUU | |
Percentage efficacy of ASP-siRNA for mutant allele: | 50 | |
Wild allele (5'->3'): | AGAUCAAGACCCUCAACAA | |
ASP-siRNA (As strand 3'->5'): | UCUAGUUCUGGGAGUUUUU | |
Percentage efficacy of ASP-siRNA for wild allele: | 85 | |
Relative difference: | -35 | |
Wild siRNA details | Wild allele (5'->3'): | AGAUCAAGACCCUCAACAA |
Wild siRNA (As strand 3'->5'): | UCUAGUUCUGGGAGUUGUU | |
Percentage efficacy of wild siRNA for wild allele: | NA | |
Wild allele (5'->3'): | AGAUCAAGACCCUCAACAA | |
ASP-siRNA (As strand 3'->5'): | UCUAGUUCUGGGAGUUUUU | |
Percentage efficacy of Wild sirna for mutant allele: | NA | |
Relative difference : | NA | |
General information | Mismatch incorporated in siRNA/Target: | siRNA |
Cell-line used: | 293 FT | |
Experimental technique used: | Flourescence microscopy | |
Transfection method: | Lipofectamine 2000 | |
siRNA expression method: | Qiagen | |
Post-transfection duration: | 24 hours | |
Concentration used: | 800ng | |
Reference: | 17145926 | |
Delivery method: | Transfection | |
Article title: | SiRNA-mediated selective inhibition of mutant keratin mRNAs responsible for the skin disorder pachyonychia congenita. | |
Authors: | Hickerson RP, Smith FJ, McLean WH, Landthaler M, Leube RE, Kaspar RL. | |
Journal Reference: | Ann N Y Acad Sci. 2006 Oct;1082:56-61. |
ASPsiRNA information | siRNA Id: | aspsirna1796 |
siRNA Name: | siCD46 | |
Mismatch information | Wild siRNA (As strand 3'->5'): | GAAUAACCUCUCUCGUGCU |
ASP-siRNA (As strand 3'->5'): | GAAUAACCUCUCUCGUGCU | |
Mismatch position in siRNA: | A:C clash | |
Gene Information | Gene Name | Complement regulatory protein (CD46) |
Target Sequence (5'->3'): | GCCCCCAATATGTGAAAAG | |
Wild allele (5'->3'): | CUUAUUGGAGAGAGCACGA | |
Mutant allele (5'->3'): | CUUACUGGAGAGAGCACGA | |
Position of siRNA on target gene: | 779-797 | |
Respective Gene/Protein Resources | GenBank Accession: | NM_002389.4 |
Cytogenic location: | 1q32.2 | |
Chromosomal coordinates: | 1:207,925,382-207,968,860 | |
UniProt ID: | P15529 | |
HUGO ID: | 6953 | |
Reference SNp(RefSNP): | rs12190959 | |
Disease/Mutation information | Target Mutation: | c.104G>A, p.Cys35Tyr |
Matation type/variant: | single nucleotide variant/Missense variant | |
Mutation at gene level: | NG_009296.1:g.9964G>A | |
Pathogenic status of mutation: | Risk factor | |
Disease: | Hemolytic uremic syndrome | |
Clinical Resources | ClinVar ID: | 17049 |
KEGG disease ID: | H00106, H0027 | |
OMIM ID: | 120920 | |
COSMIC: | CD46 | |
DECIPHER: | CD46 | |
GeneTests: | CD46 | |
ASP siRNA details | Mutant allele (5'->3'): | CUUACUGGAGAGAGCACGA |
ASP-siRNA (As strand 3'->5'): | GAAUAACCUCUCUCGUGCU | |
Percentage efficacy of ASP-siRNA for mutant allele: | 83 | |
Wild allele (5'->3'): | CUUAUUGGAGAGAGCACGA | |
ASP-siRNA (As strand 3'->5'): | GAAUAACCUCUCUCGUGCU | |
Percentage efficacy of ASP-siRNA for wild allele: | 93 | |
Relative difference: | 10 | |
Wild siRNA details | Wild allele (5'->3'): | CUUAUUGGAGAGAGCACGA |
Wild siRNA (As strand 3'->5'): | GAAUAACCUCUCUCGUGCU | |
Percentage efficacy of wild siRNA for wild allele: | 93 | |
Wild allele (5'->3'): | CUUAUUGGAGAGAGCACGA | |
ASP-siRNA (As strand 3'->5'): | GAAUAACCUCUCUCGUGCU | |
Percentage efficacy of Wild sirna for mutant allele: | 83 | |
Relative difference : | 10 | |
General information | Mismatch incorporated in siRNA/Target: | siRNA |
Cell-line used: | HEK293 | |
Experimental technique used: | Dual luciferase reporter assay | |
Transfection method: | Lipofectamine 2000 | |
siRNA expression method: | Dharmacon | |
Post-transfection duration: | 24 hours | |
Concentration used: | 13nM | |
Reference: | 15781493 | |
Delivery method: | Transfection | |
Article title: | A systematic analysis of the silencing effects of an active siRNA at all single-nucleotide mismatched target sites. | |
Authors: | Du Q, Thonberg H, Wang J, Wahlestedt C, Liang Z. | |
Journal Reference: | Nucleic Acids Res. 2005 Mar 21;33(5):1671-7. Print 2005. Erratum in: Nucleic Acids Res. 2005;33(11):3698. |