| ASPsiRNA information | siRNA Id: | aspsirna1804 |
| siRNA Name: | s1 | |
| Mismatch information | Wild siRNA (As strand 3'->5'): | CGCGAAGUCCGUGAUGUUUAU |
| ASP-siRNA (As strand 3'->5'): | GGCGAAGUCCGUGAUGUUUAU | |
| Mismatch position in siRNA: | G21C | |
| Gene Information | Gene Name | Coagulation factor III (thromboplastin, tissue factor) (F3) /CD142 |
| Target Sequence (5'->3'): | AGGTGGCCGGCGCTTCAGGCACTACAAATACTGTGG | |
| Wild allele (5'->3'): | GCGCUUCAGGCACUACAAAUA | |
| Mutant allele (5'->3'): | CCGCUUCAGGCACUACAAAUA | |
| Position of siRNA on target gene: | 313-333 | |
| Respective Gene/Protein Resources | GenBank Accession: | NM_001178096.1 |
| Cytogenic location: | 1p21.3 | |
| Chromosomal coordinates: | 1:94,994,731-95,007,412 | |
| UniProt ID: | Q99081 | |
| HUGO ID: | 3541 | |
| Reference SNp(RefSNP): | rs26759878 | |
| Disease/Mutation information | Target Mutation: | c.489G>A,p.Arg163= |
| Matation type/variant: | single nucleotide variant/synonymous variant | |
| Mutation at gene level: | NG_029366.1:g.13666G>A | |
| Pathogenic status of mutation: | Not provided | |
| Disease: | Malignant melanoma | |
| Clinical Resources | ClinVar ID: | NA |
| KEGG disease ID: | NA | |
| OMIM ID: | 134390 | |
| COSMIC: | F3 /CD142 | |
| DECIPHER: | F3 /CD142 | |
| GeneTests: | F3 /CD142 | |
| ASP siRNA details | Mutant allele (5'->3'): | CCGCUUCAGGCACUACAAAUA |
| ASP-siRNA (As strand 3'->5'): | GGCGAAGUCCGUGAUGUUUAU | |
| Percentage efficacy of ASP-siRNA for mutant allele: | NA | |
| Wild allele (5'->3'): | GCGCUUCAGGCACUACAAAUA | |
| ASP-siRNA (As strand 3'->5'): | GGCGAAGUCCGUGAUGUUUAU | |
| Percentage efficacy of ASP-siRNA for wild allele: | NA | |
| Relative difference: | NA | |
| Wild siRNA details | Wild allele (5'->3'): | GCGCUUCAGGCACUACAAAUA |
| Wild siRNA (As strand 3'->5'): | CGCGAAGUCCGUGAUGUUUAU | |
| Percentage efficacy of wild siRNA for wild allele: | NA | |
| Wild allele (5'->3'): | GCGCUUCAGGCACUACAAAUA | |
| ASP-siRNA (As strand 3'->5'): | GGCGAAGUCCGUGAUGUUUAU | |
| Percentage efficacy of Wild sirna for mutant allele: | NA | |
| Relative difference : | NA | |
| General information | Mismatch incorporated in siRNA/Target: | siRNA |
| Cell-line used: | HaCaT | |
| Experimental technique used: | Northern blot | |
| Transfection method: | Lipofectamine 2000 | |
| siRNA expression method: | Glen Research,PerSeptive Biosystems | |
| Post-transfection duration: | 48 hours | |
| Concentration used: | 100nM | |
| Reference: | 12527766 | |
| Delivery method: | Transfection | |
| Article title: | Tolerance for mutations and chemical modifications in a siRNA. | |
| Authors: | Amarzguioui M, Holen T, Babaie E, Prydz H. | |
| Journal Reference: | Nucleic Acids Res. 2003 Jan 15;31(2):589-95. |
| ASPsiRNA information | siRNA Id: | aspsirna1804 |
| siRNA Name: | siCD46 | |
| Mismatch information | Wild siRNA (As strand 3'->5'): | GAAUAACCUCUCUCGUGCU |
| ASP-siRNA (As strand 3'->5'): | GAAUAACCUCUCUCGUGCU | |
| Mismatch position in siRNA: | C:C clash | |
| Gene Information | Gene Name | Complement regulatory protein (CD46) |
| Target Sequence (5'->3'): | GCCCCCAATATGTGAAAAG | |
| Wild allele (5'->3'): | CUUAUUGGAGAGAGCACGA | |
| Mutant allele (5'->3'): | CUUAUUCGAGAGAGCACGA | |
| Position of siRNA on target gene: | 779-797 | |
| Respective Gene/Protein Resources | GenBank Accession: | NM_002389.4 |
| Cytogenic location: | 1q32.2 | |
| Chromosomal coordinates: | 1:207,925,382-207,968,860 | |
| UniProt ID: | P15529 | |
| HUGO ID: | 6953 | |
| Reference SNp(RefSNP): | rs12190959 | |
| Disease/Mutation information | Target Mutation: | c.104G>A, p.Cys35Tyr |
| Matation type/variant: | single nucleotide variant/Missense variant | |
| Mutation at gene level: | NG_009296.1:g.9964G>A | |
| Pathogenic status of mutation: | Risk factor | |
| Disease: | Hemolytic uremic syndrome | |
| Clinical Resources | ClinVar ID: | 17049 |
| KEGG disease ID: | H00106, H0027 | |
| OMIM ID: | 120920 | |
| COSMIC: | CD46 | |
| DECIPHER: | CD46 | |
| GeneTests: | CD46 | |
| ASP siRNA details | Mutant allele (5'->3'): | CUUAUUCGAGAGAGCACGA |
| ASP-siRNA (As strand 3'->5'): | GAAUAACCUCUCUCGUGCU | |
| Percentage efficacy of ASP-siRNA for mutant allele: | 16 | |
| Wild allele (5'->3'): | CUUAUUGGAGAGAGCACGA | |
| ASP-siRNA (As strand 3'->5'): | GAAUAACCUCUCUCGUGCU | |
| Percentage efficacy of ASP-siRNA for wild allele: | 93 | |
| Relative difference: | 77 | |
| Wild siRNA details | Wild allele (5'->3'): | CUUAUUGGAGAGAGCACGA |
| Wild siRNA (As strand 3'->5'): | GAAUAACCUCUCUCGUGCU | |
| Percentage efficacy of wild siRNA for wild allele: | 93 | |
| Wild allele (5'->3'): | CUUAUUGGAGAGAGCACGA | |
| ASP-siRNA (As strand 3'->5'): | GAAUAACCUCUCUCGUGCU | |
| Percentage efficacy of Wild sirna for mutant allele: | 16 | |
| Relative difference : | 77 | |
| General information | Mismatch incorporated in siRNA/Target: | siRNA |
| Cell-line used: | HEK293 | |
| Experimental technique used: | Dual luciferase reporter assay | |
| Transfection method: | Lipofectamine 2000 | |
| siRNA expression method: | Dharmacon | |
| Post-transfection duration: | 24 hours | |
| Concentration used: | 13nM | |
| Reference: | 15781493 | |
| Delivery method: | Transfection | |
| Article title: | A systematic analysis of the silencing effects of an active siRNA at all single-nucleotide mismatched target sites. | |
| Authors: | Du Q, Thonberg H, Wang J, Wahlestedt C, Liang Z. | |
| Journal Reference: | Nucleic Acids Res. 2005 Mar 21;33(5):1671-7. Print 2005. Erratum in: Nucleic Acids Res. 2005;33(11):3698. |