| ASPsiRNA information | siRNA Id: | aspsirna1841 |
| siRNA Name: | RMC466 w | |
| Mismatch information | Wild siRNA (As strand 3'->5'): | ACCGGUACCCGAGGACCACCU |
| ASP-siRNA (As strand 3'->5'): | ACCGGUACCCGAGGACCAUCU | |
| Mismatch position in siRNA: | NA | |
| Gene Information | Gene Name | Aquaporin 4 (Aqp4) |
| Target Sequence (5'->3'): | UGGCCAUGGGCUCCUGGUAGA | |
| Wild allele (5'->3'): | UGGCCAUGGGCUCCUGGUGGA | |
| Mutant allele (5'->3'): | UGGCCAUGGGCUCCUGGUAGA | |
| Position of siRNA on target gene: | NA | |
| Respective Gene/Protein Resources | GenBank Accession: | NM_009700 |
| Cytogenic location: | 18q11.2 | |
| Chromosomal coordinates: | 18:24,432,006-24,445,734 | |
| UniProt ID: | P55087 | |
| HUGO ID: | 637 | |
| Reference SNp(RefSNP): | NA | |
| Disease/Mutation information | Target Mutation: | NA |
| Matation type/variant: | NA | |
| Mutation at gene level: | NA | |
| Pathogenic status of mutation: | Mutation tolerance study | |
| Disease: | Brain edema | |
| Clinical Resources | ClinVar ID: | NA |
| KEGG disease ID: | H00106 | |
| OMIM ID: | 600308 | |
| COSMIC: | Aqp4 | |
| DECIPHER: | Aqp4 | |
| GeneTests: | Aqp4 | |
| ASP siRNA details | Mutant allele (5'->3'): | UGGCCAUGGGCUCCUGGUAGA |
| ASP-siRNA (As strand 3'->5'): | ACCGGUACCCGAGGACCAUCU | |
| Percentage efficacy of ASP-siRNA for mutant allele: | 10 | |
| Wild allele (5'->3'): | UGGCCAUGGGCUCCUGGUGGA | |
| ASP-siRNA (As strand 3'->5'): | ACCGGUACCCGAGGACCAUCU | |
| Percentage efficacy of ASP-siRNA for wild allele: | 42 | |
| Relative difference: | -32 | |
| Wild siRNA details | Wild allele (5'->3'): | UGGCCAUGGGCUCCUGGUGGA |
| Wild siRNA (As strand 3'->5'): | ACCGGUACCCGAGGACCACCU | |
| Percentage efficacy of wild siRNA for wild allele: | 35 | |
| Wild allele (5'->3'): | UGGCCAUGGGCUCCUGGUGGA | |
| ASP-siRNA (As strand 3'->5'): | ACCGGUACCCGAGGACCAUCU | |
| Percentage efficacy of Wild sirna for mutant allele: | NA | |
| Relative difference : | NA | |
| General information | Mismatch incorporated in siRNA/Target: | siRNA |
| Cell-line used: | HeLa | |
| Experimental technique used: | Dual luciferase reporter assay | |
| Transfection method: | Lipofectamine 2000 | |
| siRNA expression method: | Ambion | |
| Post-transfection duration: | 24 hours | |
| Concentration used: | 1.44mg | |
| Reference: | 16113241 | |
| Delivery method: | Transfection | |
| Article title: | Tolerated wobble mutations in siRNAs decrease specificity, but can enhance activity in vivo. | |
| Authors: | Holen T, Moe SE, Sørbø JG, Meza TJ, Ottersen OP, Klungland A. | |
| Journal Reference: | Nucleic Acids Res. 2005 Aug 19;33(15):4704-10. Print 2005. |
| ASPsiRNA information | siRNA Id: | aspsirna1841 |
| siRNA Name: | siCD46 | |
| Mismatch information | Wild siRNA (As strand 3'->5'): | NA |
| ASP-siRNA (As strand 3'->5'): | GAAUAACCUCUCUCGUGCU | |
| Mismatch position in siRNA: | G:C pair | |
| Gene Information | Gene Name | Complement regulatory protein (CD46) |
| Target Sequence (5'->3'): | GCCCCCAATATGTGAAAAG | |
| Wild allele (5'->3'): | NA | |
| Mutant allele (5'->3'): | CUUAUUGGAGAGAGCACGA | |
| Position of siRNA on target gene: | 779-797 | |
| Respective Gene/Protein Resources | GenBank Accession: | NM_002389.4 |
| Cytogenic location: | 17p13 | |
| Chromosomal coordinates: | 17:7,387,697-7,417,934 | |
| UniProt ID: | P15529 | |
| HUGO ID: | 6953 | |
| Reference SNp(RefSNP): | rs12190959 | |
| Disease/Mutation information | Target Mutation: | c.104G>A, p.Cys35Tyr |
| Matation type/variant: | single nucleotide variant/synonymous variant | |
| Mutation at gene level: | NG_009296.1:g.9964G>A | |
| Pathogenic status of mutation: | Risk factor | |
| Disease: | Hemolytic uremic syndrome | |
| Clinical Resources | ClinVar ID: | 17049 |
| KEGG disease ID: | H00106, H0027 | |
| OMIM ID: | 120920 | |
| COSMIC: | CD46 | |
| DECIPHER: | CD46 | |
| GeneTests: | CD46 | |
| ASP siRNA details | Mutant allele (5'->3'): | CUUAUUGGAGAGAGCACGA |
| ASP-siRNA (As strand 3'->5'): | GAAUAACCUCUCUCGUGCU | |
| Percentage efficacy of ASP-siRNA for mutant allele: | 93 | |
| Wild allele (5'->3'): | NA | |
| ASP-siRNA (As strand 3'->5'): | GAAUAACCUCUCUCGUGCU | |
| Percentage efficacy of ASP-siRNA for wild allele: | NA | |
| Relative difference: | NA | |
| Wild siRNA details | Wild allele (5'->3'): | NA |
| Wild siRNA (As strand 3'->5'): | NA | |
| Percentage efficacy of wild siRNA for wild allele: | NA | |
| Wild allele (5'->3'): | NA | |
| ASP-siRNA (As strand 3'->5'): | GAAUAACCUCUCUCGUGCU | |
| Percentage efficacy of Wild sirna for mutant allele: | 93 | |
| Relative difference : | NA | |
| General information | Mismatch incorporated in siRNA/Target: | siRNA |
| Cell-line used: | HEK293 | |
| Experimental technique used: | Dual luciferase reporter assay | |
| Transfection method: | Lipofectamine 2000 | |
| siRNA expression method: | Dharmacon | |
| Post-transfection duration: | 24 hours | |
| Concentration used: | 13nM | |
| Reference: | 15781493 | |
| Delivery method: | Transfection | |
| Article title: | A systematic analysis of the silencing effects of an active siRNA at all single-nucleotide mismatched target sites. | |
| Authors: | Du Q, Thonberg H, Wang J, Wahlestedt C, Liang Z. | |
| Journal Reference: | Nucleic Acids Res. 2005 Mar 21;33(5):1671-7. Print 2005. Erratum in: Nucleic Acids Res. 2005;33(11):3698. |