| | |
| ASPsiRNA information |
siRNA Id: | aspsirna2140
|
|
siRNA Name: | 581449
|
| Mismatch information |
Wild siRNA (As strand 3'->5'): | GUCGUCGUCGUCGUCU
|
|
ASP-siRNA (As strand 3'->5'): | GUCGUCGACGUCGUCU
|
|
Mismatch position in siRNA: | A9U |
| Gene Information |
Gene Name | Hungtintin (HTT) |
|
Target Sequence (5'->3'): | CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA
|
|
Wild allele (5'->3'): | CAGCAGCAGCAGCAGA
|
|
Mutant allele (5'->3'): | CAGCAGCUGCAGCAGA
|
|
Position of siRNA on target gene: | 368-382
|
| Respective Gene/Protein Resources |
GenBank Accession: | NM_002111.7 |
| Cytogenic location: | 4p16.3 |
| Chromosomal coordinates: | 4:3,076,407-3,245,686 |
| UniProt ID: | P42858 |
| HUGO ID: | 4851 |
|
Reference SNp(RefSNP): | rs19392295 |
| Disease/Mutation information |
Target Mutation: | c.52CAG(36_39)
|
|
Matation type/variant: | microsatellite
|
|
Mutation at gene level: | NG_009378.1:g.5197CAG(36_39)
|
|
Pathogenic status of mutation: | Pathogenic
|
|
Disease: | Huntington disease (HD) |
| Clinical Resources |
ClinVar ID: | 31916 |
|
KEGG disease ID: | H00059 |
|
OMIM ID: | 143100 |
|
COSMIC: | HTT |
|
DECIPHER: | HTT |
|
GeneTests: | HTT |
| ASP siRNA details |
Mutant allele (5'->3'): | CAGCAGCUGCAGCAGA
|
|
ASP-siRNA (As strand 3'->5'): | GUCGUCGACGUCGUCU
|
|
Percentage efficacy of ASP-siRNA for mutant allele: | 90
|
|
Wild allele (5'->3'): | CAGCAGCAGCAGCAGA
|
|
ASP-siRNA (As strand 3'->5'): | GUCGUCGACGUCGUCU
|
|
Percentage efficacy of ASP-siRNA for wild allele: | 40
|
|
Relative difference: | 50
|
| Wild siRNA details |
Wild allele (5'->3'): | CAGCAGCAGCAGCAGA
|
|
Wild siRNA (As strand 3'->5'): | GUCGUCGUCGUCGUCU
|
|
Percentage efficacy of wild siRNA for wild allele: | NA
|
|
Wild allele (5'->3'): | CAGCAGCAGCAGCAGA
|
|
ASP-siRNA (As strand 3'->5'): | GUCGUCGACGUCGUCU
|
|
Percentage efficacy of Wild sirna for mutant allele: | NA
|
|
Relative difference : | NA
|
| General information |
Mismatch incorporated in siRNA/Target: | siRNA |
| Cell-line used: | GM04281/GM04869 |
| Experimental technique used: | Western blot |
| Transfection method: | RNAiMAX |
| siRNA expression method: | Applied Biosystems |
| Post-transfection duration: | 48 hours |
| Concentration used: | 25nM |
| Reference: | 24694346 |
| Delivery method: | Transfection |
'| Article title: | Exploring the effect of sequence length and composition on allele-selective inhibition of human huntingtin expression by single-stranded silencing RNAs. |
'| Authors: | Hu J, Liu J, Yu D, Aiba Y, Lee S, Pendergraff H, Boubaker J, Artates JW, Lagier-Tourenne C, Lima WF, Swayze EE, Prakash TP, Corey DR. |
'| Journal Reference: | Nucleic Acid Ther. 2014 Jun;24(3):199-209. doi: 10.1089/nat.2013.0476. Epub 2014 Apr 2 |
'