| | |
ASPsiRNA information |
siRNA Id: | aspsirna2147
|
siRNA Name: | 573310
|
Mismatch information |
Wild siRNA (As strand 3'->5'): | GUCGUCUACGUCGUCU
|
ASP-siRNA (As strand 3'->5'): | GUCGUCGACGUCGUCU-VP
|
Mismatch position in siRNA: | A10U |
Gene Information |
Gene Name | Hungtintin (HTT) |
Target Sequence (5'->3'): | CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA
|
Wild allele (5'->3'): | CAGCAGAUGCAGCAGA
|
Mutant allele (5'->3'): | CAGCAGCUGCAGCAGA-VP
|
Position of siRNA on target gene: | NA
|
Respective Gene/Protein Resources |
GenBank Accession: | NM_002111.7 |
Cytogenic location: | 4p16.3 |
Chromosomal coordinates: | 4:3,076,407-3,245,686 |
UniProt ID: | P42858 |
HUGO ID: | 4851 |
Reference SNp(RefSNP): | rs19392295 |
Disease/Mutation information |
Target Mutation: | c.52CAG(36_39)
|
Matation type/variant: | microsatellite
|
Mutation at gene level: | NG_009378.1:g.5197CAG(36_39)
|
Pathogenic status of mutation: | Pathogenic
|
Disease: | Huntington disease (HD) |
Clinical Resources |
ClinVar ID: | 31916 |
KEGG disease ID: | H00059 |
OMIM ID: | 143100 |
COSMIC: | HTT |
DECIPHER: | HTT |
GeneTests: | HTT |
ASP siRNA details |
Mutant allele (5'->3'): | CAGCAGCUGCAGCAGA-VP
|
ASP-siRNA (As strand 3'->5'): | GUCGUCGACGUCGUCU-VP
|
Percentage efficacy of ASP-siRNA for mutant allele: | 80
|
Wild allele (5'->3'): | CAGCAGAUGCAGCAGA
|
ASP-siRNA (As strand 3'->5'): | GUCGUCGACGUCGUCU-VP
|
Percentage efficacy of ASP-siRNA for wild allele: | 24
|
Relative difference: | 56
|
Wild siRNA details |
Wild allele (5'->3'): | CAGCAGAUGCAGCAGA
|
Wild siRNA (As strand 3'->5'): | GUCGUCUACGUCGUCU
|
Percentage efficacy of wild siRNA for wild allele: | NA
|
Wild allele (5'->3'): | CAGCAGAUGCAGCAGA
|
ASP-siRNA (As strand 3'->5'): | GUCGUCGACGUCGUCU-VP
|
Percentage efficacy of Wild sirna for mutant allele: | NA
|
Relative difference : | NA
|
General information |
Mismatch incorporated in siRNA/Target: | siRNA
|
Cell-line used: | GM04281/GM04869 |
Experimental technique used: | Western blot |
Transfection method: | RNAiMAX |
siRNA expression method: | Applied Biosystems |
Post-transfection duration: | 48 hours |
Concentration used: | 25nM |
Reference: | 24694346 |
Delivery method: | Transfection |
Article title: | Exploring the effect of sequence length and composition on allele-selective inhibition of human huntingtin expression by single-stranded silencing RNAs. |
Authors: | Hu J, Liu J, Yu D, Aiba Y, Lee S, Pendergraff H, Boubaker J, Artates JW, Lagier-Tourenne C, Lima WF, Swayze EE, Prakash TP, Corey DR. |
Journal Reference: | Nucleic Acid Ther. 2014 Jun;24(3):199-209. doi: 10.1089/nat.2013.0476. Epub 2014 Apr 2 |