aspsirna2164 details

''''
ASPsiRNA information siRNA Id:aspsirna2164
siRNA Name: 618209
Mismatch information Wild siRNA (As strand 3'->5'):UCGUCGUCGUCGUCU
ASP-siRNA (As strand 3'->5'):UCGUCGACGUCGUCU-P
Mismatch position in siRNA: A9U
Gene Information Gene Name Hungtintin (HTT)
Target Sequence (5'->3'):CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA
Wild allele (5'->3'):AGCAGCAGCAGCAGA
Mutant allele (5'->3'):UUAGCAGCUGCAGCAGA-P
Position of siRNA on target gene: NA
Respective Gene/Protein Resources GenBank Accession:NM_002111.7
Cytogenic location:4p16.3
Chromosomal coordinates:4:3,076,407-3,245,686
UniProt ID:P42858
HUGO ID:4851
Reference SNp(RefSNP): rs19392295
Disease/Mutation information Target Mutation: c.52CAG(36_39)
Matation type/variant: microsatellite
Mutation at gene level: NG_009378.1:g.5197CAG(36_39)
Pathogenic status of mutation: Pathogenic
Disease:Huntington disease (HD)
Clinical Resources ClinVar ID:31916
KEGG disease ID:H00059
OMIM ID: 143100
COSMIC: HTT
DECIPHER: HTT
GeneTests: HTT
ASP siRNA details Mutant allele (5'->3'): UUAGCAGCUGCAGCAGA-P
ASP-siRNA (As strand 3'->5'):UCGUCGACGUCGUCU-P
Percentage efficacy of ASP-siRNA for mutant allele:88
Wild allele (5'->3'): AGCAGCAGCAGCAGA
ASP-siRNA (As strand 3'->5'):UCGUCGACGUCGUCU-P
Percentage efficacy of ASP-siRNA for wild allele:34
Relative difference:54
Wild siRNA details Wild allele (5'->3'): AGCAGCAGCAGCAGA
Wild siRNA (As strand 3'->5'):UCGUCGUCGUCGUCU
Percentage efficacy of wild siRNA for wild allele:NA
Wild allele (5'->3'): AGCAGCAGCAGCAGA
ASP-siRNA (As strand 3'->5'):UCGUCGACGUCGUCU-P
Percentage efficacy of Wild sirna for mutant allele:NA
Relative difference :NA
General information Mismatch incorporated in siRNA/Target:siRNA
Cell-line used: GM04281/GM04869
Experimental technique used: Western blot
Transfection method: RNAiMAX
siRNA expression method: Applied Biosystems
Post-transfection duration: 48 hours
Concentration used:25nM
Reference:24694346
Delivery method:Lentiviral vector delivery
Article title:Exploring the effect of sequence length and composition on allele-selective inhibition of human huntingtin expression by single-stranded silencing RNAs.
Authors:Hu J, Liu J, Yu D, Aiba Y, Lee S, Pendergraff H, Boubaker J, Artates JW, Lagier-Tourenne C, Lima WF, Swayze EE, Prakash TP, Corey DR.
Journal Reference:Nucleic Acid Ther. 2014 Jun;24(3):199-209. doi: 10.1089/nat.2013.0476. Epub 2014 Apr 2