| | |
ASPsiRNA information |
siRNA Id: | aspsirna2212
|
siRNA Name: | AB3
|
Mismatch information |
Wild siRNA (As strand 3'->5'): | GUCGUCGUCGUCGUCGUCG
|
ASP-siRNA (As strand 3'->5'): | UUGUCGUCGUCGUCGUCG
|
Mismatch position in siRNA: | 9U |
Gene Information |
Gene Name | Atrophin-1 (ATN-1) |
Target Sequence (5'->3'): | CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCATCACG
|
Wild allele (5'->3'): | CAGCAGCAGCAGCAGCAGC
|
Mutant allele (5'->3'): | AACAGCAGCUGCAGCAGC
|
Position of siRNA on target gene: | 1699-1717,1720-1738
|
Respective Gene/Protein Resources |
GenBank Accession: | NM_001007026.1 |
Cytogenic location: | 12p13.31 |
Chromosomal coordinates: | 12:7,033,625-7,051,483 |
UniProt ID: | P54259 |
HUGO ID: | NA |
Reference SNp(RefSNP): | rs19392293 |
Disease/Mutation information |
Target Mutation: | c.1462_1464CAG(90_93)
|
Matation type/variant: | STR short tandem repeat (microsatellite) variation
|
Mutation at gene level: | NG_008047.1:g.17267_17269CAG(90_93)
|
Pathogenic status of mutation: | Pathogenic
|
Disease: | Dentatorubral-pallidoluysian atrophy (DRPLA) |
Clinical Resources |
ClinVar ID: | 38905 |
KEGG disease ID: | K05626 |
OMIM ID: | 125370 |
COSMIC: | ATN-1 |
DECIPHER: | ATN-1 |
GeneTests: | ATN-1 |
ASP siRNA details |
Mutant allele (5'->3'): | AACAGCAGCUGCAGCAGC
|
ASP-siRNA (As strand 3'->5'): | UUGUCGUCGUCGUCGUCG
|
Percentage efficacy of ASP-siRNA for mutant allele: | 93
|
Wild allele (5'->3'): | CAGCAGCAGCAGCAGCAGC
|
ASP-siRNA (As strand 3'->5'): | UUGUCGUCGUCGUCGUCG
|
Percentage efficacy of ASP-siRNA for wild allele: | 10
|
Relative difference: | 83
|
Wild siRNA details |
Wild allele (5'->3'): | CAGCAGCAGCAGCAGCAGC
|
Wild siRNA (As strand 3'->5'): | GUCGUCGUCGUCGUCGUCG
|
Percentage efficacy of wild siRNA for wild allele: | 80
|
Wild allele (5'->3'): | CAGCAGCAGCAGCAGCAGC
|
ASP-siRNA (As strand 3'->5'): | UUGUCGUCGUCGUCGUCG
|
Percentage efficacy of Wild sirna for mutant allele: | 60
|
Relative difference : | 20
|
General information |
Mismatch incorporated in siRNA/Target: | siRNA |
Cell-line used: | Fibroblast |
Experimental technique used: | Western blot |
Transfection method: | RNAiMAX |
siRNA expression method: | Isis Pharmaceuticals |
Post-transfection duration: | 48 hours |
Concentration used: | 50nM |
Reference: | 24981774 |
Delivery method: | Transfection |
'Article title: | Allele-selective inhibition of mutant atrophin-1 expression by duplex and single-stranded RNAs. |
'Authors: | Hu J, Liu J, Narayanannair KJ, Lackey JG, Kuchimanchi S, Rajeev KG, Manoharan M, Swayze EE, Lima WF, Prakash TP, Xiang Q, Martinez C, Corey DR |
'Journal Reference: | Biochemistry. 2014 Jul 22;53(28):4510-8. doi: 10.1021/bi500610r. Epub 2014 Jul 11 |
'