| | |
| ASPsiRNA information |
siRNA Id: | aspsirna3231
|
|
siRNA Name: | siN159D-13
|
| Mismatch information |
Wild siRNA (As strand 3'->5'): | AGACUUGUUGUUCAAGCGGAGG
|
|
ASP-siRNA (As strand 3'->5'): | AGACUUG---UUCAAGCGGAGG
|
|
Mismatch position in siRNA: | del_8A,9A,10C, |
| Gene Information |
Gene Name | Keratin 75 (KRT75) |
|
Target Sequence (5'->3'): | ACGGGAGCAGATCAAGACTCTGAACAACAAGTTCGCCTCCTTC
|
|
Wild allele (5'->3'): | UCUGAACAACAAGUUCGCCUCC
|
|
Mutant allele (5'->3'): | UCUGAAC---AAGUUCGCCUCC
|
|
Position of siRNA on target gene: | NA
|
| Respective Gene/Protein Resources |
GenBank Accession: | NM_004693.2 |
| Cytogenic location: | 12q13.13 |
| Chromosomal coordinates: | 12:52,424,069-52,434,325 |
| UniProt ID: | O95678 |
| HUGO ID: | 24431 |
|
Reference SNp(RefSNP): | NA |
| Disease/Mutation information |
Target Mutation: | c.545_547del,p.N159del
|
|
Matation type/variant: | Deletion
|
|
Mutation at gene level: | NA
|
|
Pathogenic status of mutation: | NA
|
|
Disease: | Hair shaft blebbing |
| Clinical Resources |
ClinVar ID: | NA |
|
KEGG disease ID: | NA |
|
OMIM ID: | NA |
|
COSMIC: | KRT75 |
|
DECIPHER: | KRT75 |
|
GeneTests: | KRT75 |
| ASP siRNA details |
Mutant allele (5'->3'): | UCUGAAC---AAGUUCGCCUCC
|
|
ASP-siRNA (As strand 3'->5'): | AGACUUG---UUCAAGCGGAGG
|
|
Percentage efficacy of ASP-siRNA for mutant allele: | 48
|
|
Wild allele (5'->3'): | UCUGAACAACAAGUUCGCCUCC
|
|
ASP-siRNA (As strand 3'->5'): | AGACUUG---UUCAAGCGGAGG
|
|
Percentage efficacy of ASP-siRNA for wild allele: | 44
|
|
Relative difference: | 4
|
| Wild siRNA details |
Wild allele (5'->3'): | UCUGAACAACAAGUUCGCCUCC
|
|
Wild siRNA (As strand 3'->5'): | AGACUUGUUGUUCAAGCGGAGG
|
|
Percentage efficacy of wild siRNA for wild allele: | 50
|
|
Wild allele (5'->3'): | UCUGAACAACAAGUUCGCCUCC
|
|
ASP-siRNA (As strand 3'->5'): | AGACUUG---UUCAAGCGGAGG
|
|
Percentage efficacy of Wild sirna for mutant allele: | 42
|
|
Relative difference : | 8
|
| General information |
Mismatch incorporated in siRNA/Target: | siRNA |
| Cell-line used: | Primary keratinocytes |
| Experimental technique used: | qRT-PCR |
| Transfection method: | Lipofectamine 2000 |
| siRNA expression method: | Thermo Fisher |
| Post-transfection duration: | 48 hours |
| Concentration used: | 15 nM |
| Reference: | 26763422 |
| Delivery method: | shRNA-encoding lentiviral vectors |
'| Article title: | Correction of Hair Shaft Defects through Allele-Specific Silencing of Mutant Krt75 |
'| Authors: | Liu Y, Snedecor ER, Zhang X, Xu Y, Huang L, Jones EC, Zhang L, Clark RA, Roop DR, Qin C, Chen J |
'| Journal Reference: | J Invest Dermatol. 2016 Jan;136(1):45-51. doi: 10.1038/JID.2015.375 |
'