| | |
ASPsiRNA information |
siRNA Id: | aspsirna3235
|
siRNA Name: | siN159D-17
|
Mismatch information |
Wild siRNA (As strand 3'->5'): | UUGUUGUUCAAGCGGAGGAAGU
|
ASP-siRNA (As strand 3'->5'): | UUG---UUCAAGCGGAGGAAGU
|
Mismatch position in siRNA: | del_4A,5A,6C, |
Gene Information |
Gene Name | Keratin 75 (KRT75) |
Target Sequence (5'->3'): | ACGGGAGCAGATCAAGACTCTGAACAACAAGTTCGCCTCCTTC
|
Wild allele (5'->3'): | AACAACAAGUUCGCCUCCUUCA
|
Mutant allele (5'->3'): | AAC---AAGUUCGCCUCCUUCA
|
Position of siRNA on target gene: | NA
|
Respective Gene/Protein Resources |
GenBank Accession: | NM_004693.2 |
Cytogenic location: | 12q13.13 |
Chromosomal coordinates: | 12:52,424,069-52,434,325 |
UniProt ID: | O95678 |
HUGO ID: | 24431 |
Reference SNp(RefSNP): | NA |
Disease/Mutation information |
Target Mutation: | c.545_547del,p.N159del
|
Matation type/variant: | Deletion
|
Mutation at gene level: | NA
|
Pathogenic status of mutation: | NA
|
Disease: | Hair shaft blebbing |
Clinical Resources |
ClinVar ID: | NA |
KEGG disease ID: | NA |
OMIM ID: | NA |
COSMIC: | KRT75 |
DECIPHER: | KRT75 |
GeneTests: | KRT75 |
ASP siRNA details |
Mutant allele (5'->3'): | AAC---AAGUUCGCCUCCUUCA
|
ASP-siRNA (As strand 3'->5'): | UUG---UUCAAGCGGAGGAAGU
|
Percentage efficacy of ASP-siRNA for mutant allele: | 0
|
Wild allele (5'->3'): | AACAACAAGUUCGCCUCCUUCA
|
ASP-siRNA (As strand 3'->5'): | UUG---UUCAAGCGGAGGAAGU
|
Percentage efficacy of ASP-siRNA for wild allele: | 0
|
Relative difference: | 0
|
Wild siRNA details |
Wild allele (5'->3'): | AACAACAAGUUCGCCUCCUUCA
|
Wild siRNA (As strand 3'->5'): | UUGUUGUUCAAGCGGAGGAAGU
|
Percentage efficacy of wild siRNA for wild allele: | 50
|
Wild allele (5'->3'): | AACAACAAGUUCGCCUCCUUCA
|
ASP-siRNA (As strand 3'->5'): | UUG---UUCAAGCGGAGGAAGU
|
Percentage efficacy of Wild sirna for mutant allele: | 42
|
Relative difference : | 8
|
General information |
Mismatch incorporated in siRNA/Target: | siRNA |
Cell-line used: | Primary keratinocytes |
Experimental technique used: | qRT-PCR |
Transfection method: | Lipofectamine 2000 |
siRNA expression method: | Thermo Fisher |
Post-transfection duration: | 48 hours |
Concentration used: | 15 nM |
Reference: | 26763422 |
Delivery method: | shRNA-encoding lentiviral vectors |
'Article title: | Correction of Hair Shaft Defects through Allele-Specific Silencing of Mutant Krt75 |
'Authors: | Liu Y, Snedecor ER, Zhang X, Xu Y, Huang L, Jones EC, Zhang L, Clark RA, Roop DR, Qin C, Chen J |
'Journal Reference: | J Invest Dermatol. 2016 Jan;136(1):45-51. doi: 10.1038/JID.2015.375 |
'