VIRmiRNA -A database of viral miRNA
VMR_1004 details

miRNA Id:VMR_1004
Virus:Rhesus lymphocryptovirus (RLCV)
Taxonomy:View
Nomenclature:rlcv-miR-rl1-24-3p
miRNA Sequence: uaucggagauaggacuugauac
Length: 22
Predicted secondary structure (UNAfold):
GC Content (%):40.91
pre-miRNA:rlcv-mir-rl1-24
pre-miRNA Sequence:cgugcgggugcccuggcucaaguucucauuuccaauacaguuugagaaccuuguaucggagauaggacuugauaccaguuugcccgaug
Arm: 3p
Cell line: Jijoye cells
Method:Northern blot analysis, Solexa(NGS)
Reference: 19889779, 20219930
BLAST (miRBase): 8mer seed | 7mer seed
BLAST (VIRmiRNA): 8mer seed | 7mer seed
Align (miRBase): 8mer seed | 7mer seed
Align (VIRmiRNA): 8mer seed | 7mer seed
Align (Human genes): 8mer seed | 7mer seed