VIRmiRNA -A database of viral miRNA
VMR_1127 details

miRNA Id:VMR_1127
Virus:Rhesus rhadinovirus (RRV)
Taxonomy:View
Nomenclature:rrv-miR-rr1-5-5p
miRNA Sequence: cccggaacccaaagacacgugc
Length: 22
Predicted secondary structure (UNAfold):
GC Content (%):63.64
pre-miRNA:rrv-mir-rr1-5
pre-miRNA Sequence:caucguaacgcccccggaacccaaagacacgugcccguggucuuaagaucgggcguguucuuuggauuccgucucguuacgaug
Arm: 5p
Cell line: HEK293T cells
Method:Deep sequencing
Reference: 20655562
BLAST (miRBase): 8mer seed | 7mer seed
BLAST (VIRmiRNA): 8mer seed | 7mer seed
Align (miRBase): 8mer seed | 7mer seed
Align (VIRmiRNA): 8mer seed | 7mer seed
Align (Human genes): 8mer seed | 7mer seed