../../tmp/servers/virsirnadb/1793369597
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi22251aacctacacctgaagaaccag21
AY278491.2 SARS coronavirus HKU-39849, complete genome 3251.....................3271100
AY278491.2 SARS coronavirus HKU-39849, complete genome 3382...a.........._______339561
AY278554.2 SARS coronavirus CUHK-W1, complete genome 3236.....................3256100
AY278554.2 SARS coronavirus CUHK-W1, complete genome 3367...a.........._______338061
AY278741.1 SARS coronavirus Urbani, complete genome 3251.....................3271100
AY278741.1 SARS coronavirus Urbani, complete genome 3382...a.........._______339561
AY278488.2 SARS coronavirus BJ01, complete genome 3232.....................3252100
AY278488.2 SARS coronavirus BJ01, complete genome 3363...a.........._______337661
AY283794.1 SARS coronavirus Sin2500, complete genome 3235.....................3255100
AY283794.1 SARS coronavirus Sin2500, complete genome 3366...a.........._______337961
AY283795.1 SARS coronavirus Sin2677, complete genome 3235.....................3255100
AY283795.1 SARS coronavirus Sin2677, complete genome 3366...a.........._______337961
AY283796.1 SARS coronavirus Sin2679, complete genome 3235.....................3255100
AY283796.1 SARS coronavirus Sin2679, complete genome 3366...a.........._______337961
AY283797.1 SARS coronavirus Sin2748, complete genome 3235.....................3255100
AY283797.1 SARS coronavirus Sin2748, complete genome 3366...a.........._______337961
AY291451.1 SARS coronavirus TW1, complete genome 3251.....................3271100
AY291451.1 SARS coronavirus TW1, complete genome 3382...a.........._______339561
AY297028.1 SARS coronavirus ZJ01, complete genome 3237.....................3257100
AY297028.1 SARS coronavirus ZJ01, complete genome 3368...a.........._______338161
AY278489.2 SARS coronavirus GD01, complete genome 3235.....................3255100
AY278489.2 SARS coronavirus GD01, complete genome 3366...a.........._______337961
AY278487.3 SARS coronavirus BJ02, complete genome 3251.....................3271100
AY278487.3 SARS coronavirus BJ02, complete genome 3382...a.........._______339561
AY278490.3 SARS coronavirus BJ03, complete genome 3247.....................3267100
AY278490.3 SARS coronavirus BJ03, complete genome 3378...a.........._______339161
AY279354.2 SARS coronavirus BJ04, complete genome 3235.....................3255100
AY279354.2 SARS coronavirus BJ04, complete genome 3366...a.........._______337961
AY291315.1 SARS coronavirus Frankfurt 1, complete genome 3251.....................3271100
AY291315.1 SARS coronavirus Frankfurt 1, complete genome 3382...a.........._______339561
AY321118.1 SARS coronavirus TWC, complete genome 3251.....................3271100
AY321118.1 SARS coronavirus TWC, complete genome 3382...a.........._______339561
AY338174.1 SARS coronavirus Taiwan TC1, complete genome 3182.....................3202100
AY338174.1 SARS coronavirus Taiwan TC1, complete genome 3313...a.........._______332661
AY338175.1 SARS coronavirus Taiwan TC2, complete genome 3182.....................3202100
AY338175.1 SARS coronavirus Taiwan TC2, complete genome 3313...a.........._______332661
AY345986.1 SARS coronavirus CUHK-AG01, complete genome 3236.....................3256100
AY345986.1 SARS coronavirus CUHK-AG01, complete genome 3367...a.........._______338061
AY345987.1 SARS coronavirus CUHK-AG02, complete genome 3236.....................3256100
AY345987.1 SARS coronavirus CUHK-AG02, complete genome 3367...a.........._______338061
AY345988.1 SARS coronavirus CUHK-AG03, complete genome 3236.....................3256100
AY345988.1 SARS coronavirus CUHK-AG03, complete genome 3367...a.........._______338061
AY323977.2 SARS coronavirus HSR 1, complete genome 3251.....................3271100
AY323977.2 SARS coronavirus HSR 1, complete genome 3382...a.........._______339561
AY348314.1 SARS coronavirus Taiwan TC3, complete genome 3182.....................3202100
AY348314.1 SARS coronavirus Taiwan TC3, complete genome 3313...a.........._______332661
AY351680.1 SARS coronavirus ZMY 1, complete genome 3256.....................3276100
AY351680.1 SARS coronavirus ZMY 1, complete genome 3387...a.........._______340061
AP006557.1 SARS coronavirus TWH genomic RNA, complete genome 3251.....................3271100
AP006557.1 SARS coronavirus TWH genomic RNA, complete genome 3382...a.........._______339561
AP006558.1 SARS coronavirus TWJ genomic RNA, complete genome 3251.....................3271100
AP006558.1 SARS coronavirus TWJ genomic RNA, complete genome 3382...a.........._______339561
AP006559.1 SARS coronavirus TWK genomic RNA, complete genome 3251.....................3271100
AP006559.1 SARS coronavirus TWK genomic RNA, complete genome 3382...a.........._______339561
AP006560.1 SARS coronavirus TWS genomic RNA, complete genome 3251.....................3271100
AP006560.1 SARS coronavirus TWS genomic RNA, complete genome 3382...a.........._______339561
AP006561.1 SARS coronavirus TWY genomic RNA, complete genome 3251.....................3271100
AP006561.1 SARS coronavirus TWY genomic RNA, complete genome 3382...a.........._______339561
AY362698.1 SARS coronavirus TWC2, complete genome 3251.....................3271100
AY362698.1 SARS coronavirus TWC2, complete genome 3382...a.........._______339561
AY362699.1 SARS coronavirus TWC3, complete genome 3251.....................3271100
AY362699.1 SARS coronavirus TWC3, complete genome 3382...a.........._______339561
AY310120.1 SARS coronavirus FRA, complete genome 3251.....................3271100
AY310120.1 SARS coronavirus FRA, complete genome 3382...a.........._______339561
AY304486.1 SARS coronavirus SZ3, complete genome 3236.....................3256100
AY304486.1 SARS coronavirus SZ3, complete genome 3367...a.........._______338061
AY304488.1 SARS coronavirus SZ16, complete genome 3236.....................3256100
AY304488.1 SARS coronavirus SZ16, complete genome 3367...a.........._______338061
AY304495.1 SARS coronavirus GZ50, complete genome 3236.....................3256100
AY304495.1 SARS coronavirus GZ50, complete genome 3367...a.........._______338061
AY283798.2 SARS coronavirus Sin2774, complete genome 3235.....................3255100
AY283798.2 SARS coronavirus Sin2774, complete genome 3366...a.........._______337961
AY427439.1 SARS coronavirus AS, complete genome 3235.....................3255100
AY427439.1 SARS coronavirus AS, complete genome 3366...a.........._______337961
AY394977.1 SARS coronavirus GZ-A, partial genome 3200.....................3220100
AY394977.1 SARS coronavirus GZ-A, partial genome 3331...a.........._______334461
AY394978.1 SARS coronavirus GZ-B, complete genome 3179.....................3199100
AY394978.1 SARS coronavirus GZ-B, complete genome 3310...a.........._______332361
AY394979.1 SARS coronavirus GZ-C, complete genome 3199.....................3219100
AY394979.1 SARS coronavirus GZ-C, complete genome 3330...a.........._______334361
AY394980.1 SARS coronavirus GZ-D, partial genome 3205.....................3225100
AY394980.1 SARS coronavirus GZ-D, partial genome 3336...a.........._______334961
AY394981.1 SARS coronavirus HGZ8L1-A, partial genome 3200.....................3220100
AY394981.1 SARS coronavirus HGZ8L1-A, partial genome 3331...a.........._______334461
AY394982.1 SARS coronavirus HGZ8L1-B, partial genome 3199.....................3219100
AY394982.1 SARS coronavirus HGZ8L1-B, partial genome 3330...a.........._______334361
AY394983.1 SARS coronavirus HSZ2-A, complete genome 3199.....................3219100
AY394983.1 SARS coronavirus HSZ2-A, complete genome 3330...a.........._______334361
AY394984.1 SARS coronavirus HSZ-A, partial genome 3204.....................3224100
AY394984.1 SARS coronavirus HSZ-A, partial genome 3335...a.........._______334861
AY394985.1 SARS coronavirus HSZ-Bb, complete genome 3001.....................3021100
AY394985.1 SARS coronavirus HSZ-Bb, complete genome 3132...a.........._______314561
AY394986.1 SARS coronavirus HSZ-Cb, complete genome 3200.....................3220100
AY394986.1 SARS coronavirus HSZ-Cb, complete genome 3331...a.........._______334461
AY394987.1 SARS coronavirus HZS2-Fb, complete genome 3209.....................3229100
AY394987.1 SARS coronavirus HZS2-Fb, complete genome 3340...a.........._______335361
AY394988.1 SARS coronavirus JMD, partial genome 3165.....................3185100
AY394988.1 SARS coronavirus JMD, partial genome 3296...a.........._______330961
AY394989.1 SARS coronavirus HZS2-D, complete genome 3236.....................3256100
AY394989.1 SARS coronavirus HZS2-D, complete genome 3367...a.........._______338061
AY394990.1 SARS coronavirus HZS2-E, complete genome 3236.....................3256100
AY394990.1 SARS coronavirus HZS2-E, complete genome 3367...a.........._______338061
AY394991.1 SARS coronavirus HZS2-Fc, complete genome 3236.....................3256100
AY394991.1 SARS coronavirus HZS2-Fc, complete genome 3367...a.........._______338061
AY394992.1 SARS coronavirus HZS2-C, complete genome 3236.....................3256100
AY394992.1 SARS coronavirus HZS2-C, complete genome 3367...a.........._______338061
AY394993.1 SARS coronavirus HGZ8L2, complete genome 3236.....................3256100
AY394993.1 SARS coronavirus HGZ8L2, complete genome 3367...a.........._______338061
AY394994.1 SARS coronavirus HSZ-Bc, complete genome 3236.....................3256100
AY394994.1 SARS coronavirus HSZ-Bc, complete genome 3367...a.........._______338061
AY394995.1 SARS coronavirus HSZ-Cc, complete genome 3236.....................3256100
AY394995.1 SARS coronavirus HSZ-Cc, complete genome 3367...a.........._______338061
AY394996.1 SARS coronavirus ZS-B, complete genome 3236.....................3256100
AY394996.1 SARS coronavirus ZS-B, complete genome 3367...a.........._______338061
AY394997.1 SARS coronavirus ZS-A, complete genome 3236.....................3256100
AY394997.1 SARS coronavirus ZS-A, complete genome 3367...a.........._______338061
AY394998.1 SARS coronavirus LC1, complete genome 3236.....................3256100
AY394998.1 SARS coronavirus LC1, complete genome 3367...a.........._______338061
AY394999.1 SARS coronavirus LC2, complete genome 3236.....................3256100
AY394999.1 SARS coronavirus LC2, complete genome 3367...a.........._______338061
AY395000.1 SARS coronavirus LC3, complete genome 3236.....................3256100
AY395000.1 SARS coronavirus LC3, complete genome 3367...a.........._______338061
AY395001.1 SARS coronavirus LC4, complete genome 3236.....................3256100
AY395001.1 SARS coronavirus LC4, complete genome 3367...a.........._______338061
AY395002.1 SARS coronavirus LC5, complete genome 3236.....................3256100
AY395002.1 SARS coronavirus LC5, complete genome 3367...a.........._______338061
AY395003.1 SARS coronavirus ZS-C, complete genome 3200.....................3220100
AY395003.1 SARS coronavirus ZS-C, complete genome 3331...a.........._______334461
AY395004.1 SARS coronavirus HZS2-Bb, partial genome 3204.....................3224100
AY395004.1 SARS coronavirus HZS2-Bb, partial genome 3335...a.........._______334861
AY313906.1 SARS coronavirus GD69, complete genome 3251.....................3271100
AY313906.1 SARS coronavirus GD69, complete genome 3382...a.........._______339561
AY350750.1 SARS coronavirus PUMC01, complete genome 3238.....................3258100
AY350750.1 SARS coronavirus PUMC01, complete genome 3369...a.........._______338261
AY357075.1 SARS coronavirus PUMC02, complete genome 3237.....................3257100
AY357075.1 SARS coronavirus PUMC02, complete genome 3368...a.........._______338161
AY357076.1 SARS coronavirus PUMC03, complete genome 3237.....................3257100
AY357076.1 SARS coronavirus PUMC03, complete genome 3368...a.........._______338161
AY282752.2 SARS coronavirus CUHK-Su10, complete genome 3236.....................3256100
AY282752.2 SARS coronavirus CUHK-Su10, complete genome 3367...a.........._______338061
AY461660.1 SARS coronavirus SoD, complete genome 3236.....................3256100
AY461660.1 SARS coronavirus SoD, complete genome 3367...a.........._______338061
AY485277.1 SARS coronavirus Sino1-11, complete genome 3251.....................3271100
AY485277.1 SARS coronavirus Sino1-11, complete genome 3382...a.........._______339561
AY485278.1 SARS coronavirus Sino3-11, complete genome 3251.....................3271100
AY485278.1 SARS coronavirus Sino3-11, complete genome 3382...a.........._______339561
AY463059.1 SARS coronavirus ShanghaiQXC1, complete genome 3172.....................3192100
AY463059.1 SARS coronavirus ShanghaiQXC1, complete genome 3303...a.........._______331661
AY463060.1 SARS coronavirus ShanghaiQXC2, complete genome 3172.....................3192100
AY463060.1 SARS coronavirus ShanghaiQXC2, complete genome 3303...a.........._______331661
AY502923.1 SARS coronavirus TW10, complete genome 3251.....................3271100
AY502923.1 SARS coronavirus TW10, complete genome 3382...a.........._______339561
AY502924.1 SARS coronavirus TW11, complete genome 3251.....................3271100
AY502924.1 SARS coronavirus TW11, complete genome 3382...a.........._______339561
AY502925.1 SARS coronavirus TW2, complete genome 3251.....................3271100
AY502925.1 SARS coronavirus TW2, complete genome 3382...a.........._______339561
AY502926.1 SARS coronavirus TW3, complete genome 3251.....................3271100
AY502926.1 SARS coronavirus TW3, complete genome 3382...a.........._______339561
AY502927.1 SARS coronavirus TW4, complete genome 3251.....................3271100
AY502927.1 SARS coronavirus TW4, complete genome 3382...a.........._______339561
AY502928.1 SARS coronavirus TW5, complete genome 3251.....................3271100
AY502928.1 SARS coronavirus TW5, complete genome 3382...a.........._______339561
AY502929.1 SARS coronavirus TW6, complete genome 3251.....................3271100
AY502929.1 SARS coronavirus TW6, complete genome 3382...a.........._______339561
AY502930.1 SARS coronavirus TW7, complete genome 3251.....................3271100
AY502930.1 SARS coronavirus TW7, complete genome 3382...a.........._______339561
AY502931.1 SARS coronavirus TW8, complete genome 3251.....................3271100
AY502931.1 SARS coronavirus TW8, complete genome 3382...a.........._______339561
AY502932.1 SARS coronavirus TW9, complete genome 3251.....................3271100
AY502932.1 SARS coronavirus TW9, complete genome 3382...a.........._______339561
AY394850.2 SARS coronavirus WHU, complete genome 3251.....................3271100
AY394850.2 SARS coronavirus WHU, complete genome 3382...a.........._______339561
AY508724.1 SARS coronavirus NS-1, complete genome 3235.....................3255100
AY508724.1 SARS coronavirus NS-1, complete genome 3366...a.........._______337961
AY390556.1 SARS coronavirus GZ02, complete genome 3251.....................3271100
AY390556.1 SARS coronavirus GZ02, complete genome 3382...a.........._______339561
AY515512.1 SARS coronavirus HC/SZ/61/03, complete genome 3228.....................3248100
AY515512.1 SARS coronavirus HC/SZ/61/03, complete genome 3359...a.........._______337261
AY545914.1 SARS coronavirus isolate HC/SZ/79/03, complete genome 3228.....................3248100
AY545914.1 SARS coronavirus isolate HC/SZ/79/03, complete genome 3359...a.........._______337261
AY545915.1 SARS coronavirus isolate HC/SZ/DM1/03, complete genome 3219.....................3239100
AY545915.1 SARS coronavirus isolate HC/SZ/DM1/03, complete genome 3350...a.........._______336361
AY545916.1 SARS coronavirus isolate HC/SZ/266/03, complete genome 3217.....................3237100
AY545916.1 SARS coronavirus isolate HC/SZ/266/03, complete genome 3348...a.........._______336161
AY545918.1 SARS coronavirus isolate HC/GZ/32/03, complete genome 3217.....................3237100
AY545918.1 SARS coronavirus isolate HC/GZ/32/03, complete genome 3348...a.........._______336161
AY545919.1 SARS coronavirus isolate CFB/SZ/94/03, complete genome 3230.....................3250100
AY545919.1 SARS coronavirus isolate CFB/SZ/94/03, complete genome 3361...a.........._______337461
AY559081.1 SARS coronavirus Sin842, complete genome 3238.....................3258100
AY559081.1 SARS coronavirus Sin842, complete genome 3369...a.........._______338261
AY559082.1 SARS coronavirus Sin852, complete genome 3250.....................3270100
AY559082.1 SARS coronavirus Sin852, complete genome 3381...a.........._______339461
AY559083.1 SARS coronavirus Sin3408, complete genome 3285.....................3305100
AY559083.1 SARS coronavirus Sin3408, complete genome 3416...a.........._______342961
AY559084.1 SARS coronavirus Sin3765V, complete genome 3235.....................3255100
AY559084.1 SARS coronavirus Sin3765V, complete genome 3366...a.........._______337961
AY559085.1 SARS coronavirus Sin848, complete genome 3235.....................3255100
AY559085.1 SARS coronavirus Sin848, complete genome 3366...a.........._______337961
AY559086.1 SARS coronavirus Sin849, complete genome 3235.....................3255100
AY559086.1 SARS coronavirus Sin849, complete genome 3366...a.........._______337961
AY559087.1 SARS coronavirus Sin3725V, complete genome 3235.....................3255100
AY559087.1 SARS coronavirus Sin3725V, complete genome 3366...a.........._______337961
AY559088.1 SARS coronavirus SinP1, complete genome 3236.....................3256100
AY559088.1 SARS coronavirus SinP1, complete genome 3367...a.........._______338061
AY559089.1 SARS coronavirus SinP2, complete genome 3235.....................3255100
AY559089.1 SARS coronavirus SinP2, complete genome 3366...a.........._______337961
AY559090.1 SARS coronavirus SinP3, complete genome 3237.....................3257100
AY559090.1 SARS coronavirus SinP3, complete genome 3368...a.........._______338161
AY559091.1 SARS coronavirus SinP4, complete genome 3235.....................3255100
AY559091.1 SARS coronavirus SinP4, complete genome 3366...a.........._______337961
AY559092.1 SARS coronavirus SinP5, complete genome 3235.....................3255100
AY559092.1 SARS coronavirus SinP5, complete genome 3366...a.........._______337961
AY559093.1 SARS coronavirus Sin845, complete genome 3235.....................3255100
AY559093.1 SARS coronavirus Sin845, complete genome 3366...a.........._______337961
AY559094.1 SARS coronavirus Sin846, complete genome 3235.....................3255100
AY559094.1 SARS coronavirus Sin846, complete genome 3366...a.........._______337961
AY559095.1 SARS coronavirus Sin847, complete genome 3241.....................3261100
AY559095.1 SARS coronavirus Sin847, complete genome 3372...a.........._______338561
AY559096.1 SARS coronavirus Sin850, complete genome 3243.....................3263100
AY559096.1 SARS coronavirus Sin850, complete genome 3374...a.........._______338761
AY559097.1 SARS coronavirus Sin3408L, complete genome 3235.....................3255100
AY559097.1 SARS coronavirus Sin3408L, complete genome 3366...a.........._______337961
AY568539.1 SARS coronavirus GZ0401, complete genome 3201.....................3221100
AY568539.1 SARS coronavirus GZ0401, complete genome 3332...a.........._______334561
AY595412.1 SARS coronavirus LLJ-2004, complete genome 3229.....................3249100
AY595412.1 SARS coronavirus LLJ-2004, complete genome 3360...a.........._______337361
AY654624.1 SARS coronavirus TJF, complete genome 3250.....................3270100
AY654624.1 SARS coronavirus TJF, complete genome 3381...a.........._______339461
AY572034.1 SARS coronavirus civet007, complete genome 3225.....................3245100
AY572034.1 SARS coronavirus civet007, complete genome 3356...a.........._______336961
AY572035.1 SARS coronavirus civet010, complete genome 3203.....................3223100
AY572035.1 SARS coronavirus civet010, complete genome 3334...a.........._______334761
AY572038.1 SARS coronavirus civet020, complete genome 3180.....................3200100
AY572038.1 SARS coronavirus civet020, complete genome 3311...a.........._______332461
AY714217.1 SARS Coronavirus CDC#200301157, complete genome 3251.....................3271100
AY714217.1 SARS Coronavirus CDC#200301157, complete genome 3382...a.........._______339561
AY613947.1 SARS coronavirus GZ0402, complete genome 3201.....................3221100
AY613947.1 SARS coronavirus GZ0402, complete genome 3332...a.........._______334561
AY613948.1 SARS coronavirus PC4-13, complete genome 3201.....................3221100
AY613948.1 SARS coronavirus PC4-13, complete genome 3332...a.........._______334561
AY613949.1 SARS coronavirus PC4-136, complete genome 3201.....................3221100
AY613949.1 SARS coronavirus PC4-136, complete genome 3332...a.........._______334561
AY686864.1 SARS coronavirus B039, complete genome 3210.....................3230100
AY686864.1 SARS coronavirus B039, complete genome 3341...a.........._______335461
CQ918584.1 Sequence 1 from Patent WO2004096842 3236.....................3256100
CQ918584.1 Sequence 1 from Patent WO2004096842 3367...a.........._______338061
CQ918585.1 Sequence 2 from Patent WO2004096842 3236.....................3256100
CQ918585.1 Sequence 2 from Patent WO2004096842 3367...a.........._______338061
CQ918598.1 Sequence 15 from Patent WO2004096842 3251.....................3271100
CQ918598.1 Sequence 15 from Patent WO2004096842 3382...a.........._______339561
AY686863.1 SARS coronavirus A022, complete genome 3200.....................3220100
AY686863.1 SARS coronavirus A022, complete genome 3331...a.........._______334461
AY772062.1 SARS coronavirus WH20, complete genome 3261.....................3281100
AY772062.1 SARS coronavirus WH20, complete genome 3392...a.........._______340561
CS079026.1 Sequence 14 from Patent WO2005035556 3251.....................3271100
CS079026.1 Sequence 14 from Patent WO2005035556 3382...a.........._______339561
CS079027.1 Sequence 15 from Patent WO2005035556 3251.....................3271100
CS079027.1 Sequence 15 from Patent WO2005035556 3382...a.........._______339561
CS079028.1 Sequence 16 from Patent WO2005035556 3251.....................3271100
CS079028.1 Sequence 16 from Patent WO2005035556 3382...a.........._______339561
CS079029.1 Sequence 17 from Patent WO2005035556 3236.....................3256100
CS079029.1 Sequence 17 from Patent WO2005035556 3367...a.........._______338061
AY864805.1 SARS coronavirus BJ162, complete genome 3251.....................3271100
AY864805.1 SARS coronavirus BJ162, complete genome 3382...a.........._______339561
AY864806.1 SARS coronavirus BJ202, complete genome 3251.....................3271100
AY864806.1 SARS coronavirus BJ202, complete genome 3382...a.........._______339561
DQ182595.1 SARS coronavirus ZJ0301 from China, complete genome 3235.....................3255100
DQ182595.1 SARS coronavirus ZJ0301 from China, complete genome 3366...a.........._______337961
CS254197.1 Sequence 67 from Patent WO2004011647 3251.....................3271100
CS254197.1 Sequence 67 from Patent WO2004011647 3382...a.........._______339561
AB257344.1 SARS coronavirus Frankfurt 1 genomic RNA, nearly complete genome, clo3210.....................3230100
AB257344.1 SARS coronavirus Frankfurt 1 genomic RNA, nearly complete genome, clo3341...a.........._______335461
DQ497008.1 SARS coronavirus strain MA-15, complete genome 3251.....................3271100
DQ497008.1 SARS coronavirus strain MA-15, complete genome 3382...a.........._______339561
DQ640652.1 SARS coronavirus GDH-BJH01, complete genome 3258.....................3278100
DQ640652.1 SARS coronavirus GDH-BJH01, complete genome 3389...a.........._______340261
DQ898174.1 SARS coronavirus strain CV7, complete genome 3251.....................3271100
DQ898174.1 SARS coronavirus strain CV7, complete genome 3382...a.........._______339561
CS569493.1 Sequence 1 from Patent WO2006039656 3251.....................3271100
CS569493.1 Sequence 1 from Patent WO2006039656 3382...a.........._______339561
EU371559.1 SARS coronavirus ZJ02, complete genome 3251.....................3271100
EU371559.1 SARS coronavirus ZJ02, complete genome 3382...a.........._______339561
EU371560.1 SARS coronavirus BJ182a, complete genome 3251.....................3271100
EU371560.1 SARS coronavirus BJ182a, complete genome 3382...a.........._______339561
EU371561.1 SARS coronavirus BJ182b, complete genome 3251.....................3271100
EU371561.1 SARS coronavirus BJ182b, complete genome 3382...a.........._______339561
EU371562.1 SARS coronavirus BJ182-4, complete genome 3251.....................3271100
EU371562.1 SARS coronavirus BJ182-4, complete genome 3382...a.........._______339561
EU371563.1 SARS coronavirus BJ182-8, complete genome 3251.....................3271100
EU371563.1 SARS coronavirus BJ182-8, complete genome 3382...a.........._______339561
EU371564.1 SARS coronavirus BJ182-12, complete genome 3251.....................3271100
EU371564.1 SARS coronavirus BJ182-12, complete genome 3382...a.........._______339561
FJ882963.1 SARS coronavirus P2, complete genome 3232.....................3252100
FJ882963.1 SARS coronavirus P2, complete genome 3363...a.........._______337661
FJ959407.1 SARS coronavirus isolate A001, complete genome 3180.....................3200100
FJ959407.1 SARS coronavirus isolate A001, complete genome 3311...a.........._______332461
FJ882926.1 SARS coronavirus ExoN1, complete genome 3219.....................3239100
FJ882926.1 SARS coronavirus ExoN1, complete genome 3350...a.........._______336361
FJ882927.1 SARS coronavirus wtic-MB isolate P1pp1, complete genome 3231.....................3251100
FJ882927.1 SARS coronavirus wtic-MB isolate P1pp1, complete genome 3362...a.........._______337561
FJ882928.1 SARS coronavirus ExoN1 isolate P1pp1, complete genome 3231.....................3251100
FJ882928.1 SARS coronavirus ExoN1 isolate P1pp1, complete genome 3362...a.........._______337561
FJ882929.1 SARS coronavirus ExoN1 isolate P3pp1, complete genome 3230.....................3250100
FJ882929.1 SARS coronavirus ExoN1 isolate P3pp1, complete genome 3361...a.........._______337461
FJ882930.1 SARS coronavirus ExoN1, complete genome 3231.....................3251100
FJ882930.1 SARS coronavirus ExoN1, complete genome 3362...a.........._______337561
FJ882931.1 SARS coronavirus ExoN1 isolate P3pp12, complete genome 3211.....................3231100
FJ882931.1 SARS coronavirus ExoN1 isolate P3pp12, complete genome 3342...a.........._______335561
FJ882932.1 SARS coronavirus wtic-MB isolate P3pp14, complete genome 3211.....................3231100
FJ882932.1 SARS coronavirus wtic-MB isolate P3pp14, complete genome 3342...a.........._______335561
FJ882933.1 SARS coronavirus wtic-MB isolate P3pp6, complete genome 3213.....................3233100
FJ882933.1 SARS coronavirus wtic-MB isolate P3pp6, complete genome 3344...a.........._______335761
FJ882934.1 SARS coronavirus wtic-MB isolate P3pp29, complete genome 3211.....................3231100
FJ882934.1 SARS coronavirus wtic-MB isolate P3pp29, complete genome 3342...a.........._______335561
FJ882935.1 SARS coronavirus wtic-MB isolate P3pp21, complete genome 3212.....................3232100
FJ882935.1 SARS coronavirus wtic-MB isolate P3pp21, complete genome 3343...a.........._______335661
FJ882936.1 SARS coronavirus wtic-MB isolate P3pp2, complete genome 3211.....................3231100
FJ882936.1 SARS coronavirus wtic-MB isolate P3pp2, complete genome 3342...a.........._______335561
FJ882937.1 SARS coronavirus wtic-MB isolate P3pp18, complete genome 3213.....................3233100
FJ882937.1 SARS coronavirus wtic-MB isolate P3pp18, complete genome 3344...a.........._______335761
FJ882938.1 SARS coronavirus wtic-MB, complete genome 3231.....................3251100
FJ882938.1 SARS coronavirus wtic-MB, complete genome 3362...a.........._______337561
FJ882939.1 SARS coronavirus wtic-MB isolate P3pp16, complete genome 3211.....................3231100
FJ882939.1 SARS coronavirus wtic-MB isolate P3pp16, complete genome 3342...a.........._______335561
FJ882940.1 SARS coronavirus ExoN1 isolate P3pp37, complete genome 3211.....................3231100
FJ882940.1 SARS coronavirus ExoN1 isolate P3pp37, complete genome 3342...a.........._______335561
FJ882941.1 SARS coronavirus ExoN1 isolate P3pp8, complete genome 3230.....................3250100
FJ882941.1 SARS coronavirus ExoN1 isolate P3pp8, complete genome 3361...a.........._______337461
FJ882942.1 SARS coronavirus MA15 ExoN1 isolate P3pp5, complete genome 3244.....................3264100
FJ882942.1 SARS coronavirus MA15 ExoN1 isolate P3pp5, complete genome 3375...a.........._______338861
FJ882943.1 SARS coronavirus MA15 ExoN1, complete genome 3244.....................3264100
FJ882943.1 SARS coronavirus MA15 ExoN1, complete genome 3375...a.........._______338861
FJ882944.1 SARS coronavirus ExoN1 isolate P3pp23, complete genome 3193.....................3213100
FJ882944.1 SARS coronavirus ExoN1 isolate P3pp23, complete genome 3324...a.........._______333761
FJ882945.1 SARS coronavirus MA15 isolate P3pp6, complete genome 3244.....................3264100
FJ882945.1 SARS coronavirus MA15 isolate P3pp6, complete genome 3375...a.........._______338861
FJ882946.1 SARS coronavirus wtic-MB isolate P3pp13, complete genome 3212.....................3232100
FJ882946.1 SARS coronavirus wtic-MB isolate P3pp13, complete genome 3343...a.........._______335661
FJ882947.1 SARS coronavirus wtic-MB isolate P3pp7, complete genome 3211.....................3231100
FJ882947.1 SARS coronavirus wtic-MB isolate P3pp7, complete genome 3342...a.........._______335561
FJ882948.1 SARS coronavirus MA15 isolate P3pp3, complete genome 3244.....................3264100
FJ882948.1 SARS coronavirus MA15 isolate P3pp3, complete genome 3375...a.........._______338861
FJ882949.1 SARS coronavirus wtic-MB isolate P3pp23, complete genome 3212.....................3232100
FJ882949.1 SARS coronavirus wtic-MB isolate P3pp23, complete genome 3343...a.........._______335661
FJ882950.1 SARS coronavirus ExoN1 isolate P3pp60, complete genome 3211.....................3231100
FJ882950.1 SARS coronavirus ExoN1 isolate P3pp60, complete genome 3342...a.........._______335561
FJ882951.1 SARS coronavirus MA15 ExoN1 isolate P3pp3, complete genome 3244.....................3264100
FJ882951.1 SARS coronavirus MA15 ExoN1 isolate P3pp3, complete genome 3375...a.........._______338861
FJ882952.1 SARS coronavirus MA15 isolate P3pp4, complete genome 3244.....................3264100
FJ882952.1 SARS coronavirus MA15 isolate P3pp4, complete genome 3375...a.........._______338861
FJ882953.1 SARS coronavirus MA15 ExoN1 isolate P3pp4, complete genome 3213.....................3233100
FJ882953.1 SARS coronavirus MA15 ExoN1 isolate P3pp4, complete genome 3344...a.........._______335761
FJ882954.1 SARS coronavirus ExoN1 isolate P3pp46, complete genome 3204.....................3224100
FJ882954.1 SARS coronavirus ExoN1 isolate P3pp46, complete genome 3335...a.........._______334861
FJ882955.1 SARS coronavirus ExoN1 isolate P3pp19, complete genome 3211.....................3231100
FJ882955.1 SARS coronavirus ExoN1 isolate P3pp19, complete genome 3342...a.........._______335561
FJ882956.1 SARS coronavirus ExoN1 isolate P3pp53, complete genome 3211.....................3231100
FJ882956.1 SARS coronavirus ExoN1 isolate P3pp53, complete genome 3342...a.........._______335561
FJ882957.1 SARS coronavirus MA15, complete genome 3244.....................3264100
FJ882957.1 SARS coronavirus MA15, complete genome 3375...a.........._______338861
FJ882958.1 SARS coronavirus MA15 isolate P3pp7, complete genome 3244.....................3264100
FJ882958.1 SARS coronavirus MA15 isolate P3pp7, complete genome 3375...a.........._______338861
FJ882959.1 SARS coronavirus MA15 ExoN1 isolate P3pp6, complete genome 3244.....................3264100
FJ882959.1 SARS coronavirus MA15 ExoN1 isolate P3pp6, complete genome 3375...a.........._______338861
FJ882960.1 SARS coronavirus ExoN1 isolate P3pp34, complete genome 3211.....................3231100
FJ882960.1 SARS coronavirus ExoN1 isolate P3pp34, complete genome 3342...a.........._______335561
FJ882961.1 SARS coronavirus MA15 isolate P3pp5, complete genome 3244.....................3264100
FJ882961.1 SARS coronavirus MA15 isolate P3pp5, complete genome 3375...a.........._______338861
FJ882962.1 SARS coronavirus MA15 ExoN1 isolate P3pp10, complete genome 3244.....................3264100
FJ882962.1 SARS coronavirus MA15 ExoN1 isolate P3pp10, complete genome 3375...a.........._______338861
GU553363.1 SARS coronavirus HKU-39849 isolate TCVSP-HARROD-00001, complete genom3211.....................3231100
GU553363.1 SARS coronavirus HKU-39849 isolate TCVSP-HARROD-00001, complete genom3342...a.........._______335561
GU553364.1 SARS coronavirus HKU-39849 isolate TCVSP-HARROD-00002, complete genom3211.....................3231100
GU553364.1 SARS coronavirus HKU-39849 isolate TCVSP-HARROD-00002, complete genom3342...a.........._______335561
GU553365.1 SARS coronavirus HKU-39849 isolate TCVSP-HARROD-00003, complete genom3211.....................3231100
GU553365.1 SARS coronavirus HKU-39849 isolate TCVSP-HARROD-00003, complete genom3342...a.........._______335561
HQ890526.1 SARS coronavirus MA15 ExoN1 isolate d2ym1, complete genome 3211.....................3231100
HQ890526.1 SARS coronavirus MA15 ExoN1 isolate d2ym1, complete genome 3342...a.........._______335561
HQ890527.1 SARS coronavirus MA15 ExoN1 isolate d2ym2, complete genome 3211.....................3231100
HQ890527.1 SARS coronavirus MA15 ExoN1 isolate d2ym2, complete genome 3342...a.........._______335561
HQ890528.1 SARS coronavirus MA15 ExoN1 isolate d2ym3, complete genome 3211.....................3231100
HQ890528.1 SARS coronavirus MA15 ExoN1 isolate d2ym3, complete genome 3342...a.........._______335561
HQ890529.1 SARS coronavirus MA15 ExoN1 isolate d2ym4, complete genome 3211.....................3231100
HQ890529.1 SARS coronavirus MA15 ExoN1 isolate d2ym4, complete genome 3342...a.........._______335561
HQ890530.1 SARS coronavirus MA15 ExoN1 isolate d2ym5, complete genome 3211.....................3231100
HQ890530.1 SARS coronavirus MA15 ExoN1 isolate d2ym5, complete genome 3342...a.........._______335561
HQ890531.1 SARS coronavirus MA15 ExoN1 isolate d4ym1, complete genome 3211.....................3231100
HQ890531.1 SARS coronavirus MA15 ExoN1 isolate d4ym1, complete genome 3342...a.........._______335561
HQ890532.1 SARS coronavirus MA15 ExoN1 isolate d4ym2, complete genome 3211.....................3231100
HQ890532.1 SARS coronavirus MA15 ExoN1 isolate d4ym2, complete genome 3342...a.........._______335561
HQ890533.1 SARS coronavirus MA15 ExoN1 isolate d4ym3, complete genome 3211.....................3231100
HQ890533.1 SARS coronavirus MA15 ExoN1 isolate d4ym3, complete genome 3342...a.........._______335561
HQ890534.1 SARS coronavirus MA15 ExoN1 isolate d2om1, complete genome 3211.....................3231100
HQ890534.1 SARS coronavirus MA15 ExoN1 isolate d2om1, complete genome 3342...a.........._______335561
HQ890535.1 SARS coronavirus MA15 ExoN1 isolate d2om2, complete genome 3211.....................3231100
HQ890535.1 SARS coronavirus MA15 ExoN1 isolate d2om2, complete genome 3342...a.........._______335561
HQ890536.1 SARS coronavirus MA15 ExoN1 isolate d2om3, complete genome 3211.....................3231100
HQ890536.1 SARS coronavirus MA15 ExoN1 isolate d2om3, complete genome 3342...a.........._______335561
HQ890537.1 SARS coronavirus MA15 ExoN1 isolate d2om4, complete genome 3211.....................3231100
HQ890537.1 SARS coronavirus MA15 ExoN1 isolate d2om4, complete genome 3342...a.........._______335561
HQ890538.1 SARS coronavirus MA15 ExoN1 isolate d2om5, complete genome 3211.....................3231100
HQ890538.1 SARS coronavirus MA15 ExoN1 isolate d2om5, complete genome 3342...a.........._______335561
HQ890539.1 SARS coronavirus MA15 ExoN1 isolate d3om1, complete genome 3211.....................3231100
HQ890539.1 SARS coronavirus MA15 ExoN1 isolate d3om1, complete genome 3342...a.........._______335561
HQ890540.1 SARS coronavirus MA15 ExoN1 isolate d3om2, complete genome 3211.....................3231100
HQ890540.1 SARS coronavirus MA15 ExoN1 isolate d3om2, complete genome 3342...a.........._______335561
HQ890541.1 SARS coronavirus MA15 isolate d2ym1, complete genome 3211.....................3231100
HQ890541.1 SARS coronavirus MA15 isolate d2ym1, complete genome 3342...a.........._______335561
HQ890542.1 SARS coronavirus MA15 isolate d2om1, complete genome 3211.....................3231100
HQ890542.1 SARS coronavirus MA15 isolate d2om1, complete genome 3342...a.........._______335561
HQ890543.1 SARS coronavirus MA15 isolate d2om2, complete genome 3211.....................3231100
HQ890543.1 SARS coronavirus MA15 isolate d2om2, complete genome 3342...a.........._______335561
HQ890544.1 SARS coronavirus MA15 isolate d2om3, complete genome 3211.....................3231100
HQ890544.1 SARS coronavirus MA15 isolate d2om3, complete genome 3342...a.........._______335561
HQ890545.1 SARS coronavirus MA15 isolate d2om4, complete genome 3211.....................3231100
HQ890545.1 SARS coronavirus MA15 isolate d2om4, complete genome 3342...a.........._______335561
HQ890546.1 SARS coronavirus MA15 isolate d2om5, complete genome 3211.....................3231100
HQ890546.1 SARS coronavirus MA15 isolate d2om5, complete genome 3342...a.........._______335561
JF292902.1 SARS coronavirus MA15 ExoN1 isolate d4ym4, complete genome 3211.....................3231100
JF292902.1 SARS coronavirus MA15 ExoN1 isolate d4ym4, complete genome 3342...a.........._______335561
JF292903.1 SARS coronavirus MA15 ExoN1 isolate d4ym5, complete genome 3211.....................3231100
JF292903.1 SARS coronavirus MA15 ExoN1 isolate d4ym5, complete genome 3342...a.........._______335561
JF292904.1 SARS coronavirus MA15 ExoN1 isolate d3om3, complete genome 3211.....................3231100
JF292904.1 SARS coronavirus MA15 ExoN1 isolate d3om3, complete genome 3342...a.........._______335561
JF292905.1 SARS coronavirus MA15 ExoN1 isolate d3om4, complete genome 3211.....................3231100
JF292905.1 SARS coronavirus MA15 ExoN1 isolate d3om4, complete genome 3342...a.........._______335561
JF292906.1 SARS coronavirus MA15 ExoN1 isolate d3om5, complete genome 3211.....................3231100
JF292906.1 SARS coronavirus MA15 ExoN1 isolate d3om5, complete genome 3342...a.........._______335561
JF292907.1 SARS coronavirus MA15 isolate d2ym2, complete genome 3211.....................3231100
JF292907.1 SARS coronavirus MA15 isolate d2ym2, complete genome 3342...a.........._______335561
JF292908.1 SARS coronavirus MA15 isolate d2ym3, complete genome 3211.....................3231100
JF292908.1 SARS coronavirus MA15 isolate d2ym3, complete genome 3342...a.........._______335561
JF292909.1 SARS coronavirus MA15 isolate d2ym4, complete genome 3211.....................3231100
JF292909.1 SARS coronavirus MA15 isolate d2ym4, complete genome 3342...a.........._______335561
JF292910.1 SARS coronavirus MA15 isolate d2ym5, complete genome 3211.....................3231100
JF292910.1 SARS coronavirus MA15 isolate d2ym5, complete genome 3342...a.........._______335561
JF292911.1 SARS coronavirus MA15 isolate d4ym1, complete genome 3211.....................3231100
JF292911.1 SARS coronavirus MA15 isolate d4ym1, complete genome 3342...a.........._______335561
JF292912.1 SARS coronavirus MA15 isolate d4ym2, complete genome 3211.....................3231100
JF292912.1 SARS coronavirus MA15 isolate d4ym2, complete genome 3342...a.........._______335561
JF292913.1 SARS coronavirus MA15 isolate d4ym3, complete genome 3211.....................3231100
JF292913.1 SARS coronavirus MA15 isolate d4ym3, complete genome 3342...a.........._______335561
JF292914.1 SARS coronavirus MA15 isolate d4ym4, complete genome 3211.....................3231100
JF292914.1 SARS coronavirus MA15 isolate d4ym4, complete genome 3342...a.........._______335561
JF292915.1 SARS coronavirus MA15 isolate d4ym5, complete genome 3211.....................3231100
JF292915.1 SARS coronavirus MA15 isolate d4ym5, complete genome 3342...a.........._______335561
JF292916.1 SARS coronavirus MA15 isolate d3om1, complete genome 3211.....................3231100
JF292916.1 SARS coronavirus MA15 isolate d3om1, complete genome 3342...a.........._______335561
JF292917.1 SARS coronavirus MA15 isolate d3om2, complete genome 3211.....................3231100
JF292917.1 SARS coronavirus MA15 isolate d3om2, complete genome 3342...a.........._______335561
JF292918.1 SARS coronavirus MA15 isolate d3om3, complete genome 3211.....................3231100
JF292918.1 SARS coronavirus MA15 isolate d3om3, complete genome 3342...a.........._______335561
JF292919.1 SARS coronavirus MA15 isolate d3om4, complete genome 3211.....................3231100
JF292919.1 SARS coronavirus MA15 isolate d3om4, complete genome 3342...a.........._______335561
JF292920.1 SARS coronavirus MA15 isolate d3om5, complete genome 3211.....................3231100
JF292920.1 SARS coronavirus MA15 isolate d3om5, complete genome 3342...a.........._______335561
JF292921.1 SARS coronavirus wtic-MB isolate c1P1, complete genome 3211.....................3231100
JF292921.1 SARS coronavirus wtic-MB isolate c1P1, complete genome 3342...a.........._______335561
JF292922.1 SARS coronavirus ExoN1 isolate c5P1, complete genome 3211.....................3231100
JF292922.1 SARS coronavirus ExoN1 isolate c5P1, complete genome 3342...a.........._______335561
AY545917.1 SARS coronavirus isolate HC/GZ/81/03, complete genome 3215..t..................323595
AY545917.1 SARS coronavirus isolate HC/GZ/81/03, complete genome 3346...a.........._______335961
AY613950.1 SARS coronavirus PC4-227, complete genome 3201..t..................322195
AY613950.1 SARS coronavirus PC4-227, complete genome 3332...a.........._______334561
DQ084199.1 bat SARS coronavirus HKU3-2, complete genome 3216.....ct..............323690
DQ084200.1 bat SARS coronavirus HKU3-3, complete genome 3216.....ct..............323690
DQ022305.2 Bat SARS coronavirus HKU3-1, complete genome 3233.....ct..............325390
GQ153539.1 Bat SARS coronavirus HKU3-4, complete genome 3233.....ct..............325390
GQ153540.1 Bat SARS coronavirus HKU3-5, complete genome 3233.....ct..............325390
GQ153541.1 Bat SARS coronavirus HKU3-6, complete genome 3233.....ct..............325390
GQ153544.1 Bat SARS coronavirus HKU3-9, complete genome 3233.....ct..............325390
GQ153545.1 Bat SARS coronavirus HKU3-10, complete genome 3233.....ct..............325390
GQ153546.1 Bat SARS coronavirus HKU3-11, complete genome 3233.....ct..............325390
GQ153547.1 Bat SARS coronavirus HKU3-12, complete genome 3233.....ct..............325390
GQ153548.1 Bat SARS coronavirus HKU3-13, complete genome 3215.....ct..............323590
DQ071615.1 Bat SARS coronavirus Rp3, complete genome 6323.......c.........gt..634385
DQ071615.1 Bat SARS coronavirus Rp3, complete genome 3376...a.........._______338961
DQ412043.1 Bat SARS coronavirus Rm1, complete genome 3241.....ctg.............326185
DQ648857.1 Bat coronavirus (BtCoV/279/2005), complete genome 3244.....ctg.............326485