../../tmp/servers/virsirnadb/1185167200
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi14111aagacttatgatcctctctca21
U94848.1 Vaccinia virus strain Ankara, complete genomic sequence 51183.....................51203100
AF095689.1 Vaccinia virus (strain Tian Tan) complete genome 42969.....................42989100
AY313848.1 Vaccinia virus strain Acambis clone 3, complete genome 47620.....................47640100
AY313847.1 Vaccinia virus strain Acambis clone 2000, complete genome 50972.....................50992100
AY313847.1 Vaccinia virus strain Acambis clone 2000, complete genome 87_____..t.c.........._7361
AY484669.1 Rabbitpox virus, complete genome 50909.....................50929100
AY603355.1 Vaccinia virus strain Acambis 3000 Modified Virus Ankara (MVA), compl52784.....................52804100
AY678275.1 Vaccinia virus strain LC16m8, complete genome 37179.....................37199100
AY678276.1 Vaccinia virus strain Lister, complete genome 50689.....................50709100
AY678277.1 Vaccinia virus strain LC16mO, complete genome 50569.....................50589100
DQ377945.1 Vaccinia virus strain 3737, complete genome 50689.....................50709100
DQ439815.1 Vaccinia virus strain DUKE, complete genome 53483.....................53503100
DQ792504.1 Horsepox virus isolate MNR-76, complete genome 53203.....................53223100
DQ983236.1 Vaccinia virus strain MVA-I721 genomic sequence 59319.....................59339100
DQ983237.1 Vaccinia virus strain MVA-572 genomic sequence 36530.....................36550100
DQ983238.1 Vaccinia virus strain MVA-BN genomic sequence 36530.....................36550100
DQ983239.1 Vaccinia virus strain AGR-MVA-572pre genomic sequence 36330.....................36350100
DQ983240.1 Vaccinia virus strain AGR-MVA-572seq genomic sequence 36328.....................36348100
DQ121394.1 Vaccinia virus strain Lister clone VACV107, complete genome 25457.....................25477100
EF675191.1 Vaccinia virus strain MVATGN33.1 Modified Virus Ankara, complete geno50768.....................50788100
AM501482.1 Vaccinia virus Ankara strain chorioallantois vaccinia virus Ankara (C36616.....................36636100
EU410304.1 Vaccinia virus GLV-1h68, complete genome 48295.....................48315100
NC_006998.1 Vaccinia virus, complete genome 48052.....................48072100
NC_006998.1 Vaccinia virus, complete genome 237374.....................237394100