../../tmp/servers/virsirnadb/1201968097
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi14141aaggcaacgctatggcactct21
K00108.1BLCNCNP La Crosse virus genome molecule S cDNA to genomic RNA 627.....................647100
K00610.1BLCSRNA La Crosse virus S RNA, complete, coding for the N and NS-s pro627.....................647100
DQ196120.1 La Crosse virus strain 77 segment small, complete sequence 627.....................647100
EF485030.1 La Crosse virus strain LACV/human/1960 segment small, complete sequen627.....................647100
EF485033.1 La Crosse virus strain LACV/human/1978 segment small, complete sequen627.....................647100
EF485036.1 La Crosse virus strain LACV/mosquito/1978 segment small, complete seq627......g..............64795
Z68497.1 Tahyna virus RNA for N protein and RNA for NS protein, strain 92 625_.....g.........t....64485
Z68497.1 Tahyna virus RNA for N protein and RNA for NS protein, strain 92 686________.........g.__67647
U47142.1TVU47142 Tahyna virus Prototype Bardos 92 nucleocapsid protein and non624_.....g.........t....64385
U47142.1TVU47142 Tahyna virus Prototype Bardos 92 nucleocapsid protein and non685________.........g.__67547
EU294510.1 Snowshoe hare virus segment small, complete sequence 578...a...........tt.a..59880
X73468.1 Lumbo virus genomic RNA for N and NSs proteins 624.....g.........______63866
X73468.1 Lumbo virus genomic RNA for N and NSs proteins 686________.........____67842
K02539.1SSHM Snowshoe hare virus, complete M RNA segment coding for G protein 1106________.a.........__111647
EU262553.1 Snowshoe hare virus segment M G1/G2 membrane polyprotein gene, comple1087________.a.........__109747
AF123487.1 Jerry Slough virus polyprotein mRNA, complete cds 2064_________.........___207242