../../tmp/servers/virsirnadb/1715690049
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi14101aatactctcccgtcgatgtct21
U94848.1 Vaccinia virus strain Ankara, complete genomic sequence 51008........t............5102895
AY313848.1 Vaccinia virus strain Acambis clone 3, complete genome 47445........t............4746595
AY603355.1 Vaccinia virus strain Acambis 3000 Modified Virus Ankara (MVA), compl52609........t............5262995
AY678277.1 Vaccinia virus strain LC16mO, complete genome 50394........t............5041495
DQ439815.1 Vaccinia virus strain DUKE, complete genome 53308........t............5332895
DQ439815.1 Vaccinia virus strain DUKE, complete genome 153747_____...t..........._15373366
NC_006998.1 Vaccinia virus, complete genome 47877........t............4789795
NC_006998.1 Vaccinia virus, complete genome 237199........t............23721995
AY313847.1 Vaccinia virus strain Acambis clone 2000, complete genome 151239_____...t..........._15122566
AY484669.1 Rabbitpox virus, complete genome 151191_____...t..........._15117766
DQ792504.1 Horsepox virus isolate MNR-76, complete genome 153493_____...t..........._15347966
DQ983236.1 Vaccinia virus strain MVA-I721 genomic sequence 159838_____...t..........._15982466