../../tmp/servers/virsirnadb/1237408467
Result for your query siRNA sequence
| RED | =100 % Complementary sequence |
| . | =Identical residue |
| blue alphabets | =mismatch |
| _ | =Gap |
| Acc number | Strain name | Start | Alignment | End | % Identity |
| Query | virsi1983 | 1 | cataccctcctgtttaacatc | 21 | |
| X61596.1 | Hepatitis C virus core, E1, NS1/E2, NS2, NS3, NS4a, NS4b and NS5 gene | 5737 | ..................... | 5757 | 100 |
| D50485.1 | HPCK1S2 Hepatitis C virus (strain HCV-1b, clone HCV-K1-S2), complete g | 5742 | ..................... | 5762 | 100 |
| AJ000009.1 | Hepatitis C virus complete genome sequence | 5737 | ..................... | 5757 | 100 |
| AJ132996.1 | Hepatitis C virus, complete genome, isolate HCV-AD78 | 5759 | ..................... | 5779 | 100 |
| AJ132997.1 | Hepatitis C virus, complete genome, isolate HCV-AD78P1 | 5753 | ..................... | 5773 | 100 |
| AJ238799.1 | Hepatitis C virus type 1b complete genome, isolate Con1 | 5754 | ..................... | 5774 | 100 |
| AJ238800.1 | Hepatitis C virus type 1b complete genome, isolate NC1 | 5413 | ..................... | 5433 | 100 |
| AB016785.1 | Hepatitis C virus genomic RNA, complete sequence | 5758 | ..................... | 5778 | 100 |
| AF207764.1 | Hepatitis C virus subtype 1b strain MD23, complete genome | 5742 | ..................... | 5762 | 100 |
| AB049095.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT16 | 5723 | ..................... | 5743 | 100 |
| EF407469.1 | Hepatitis C virus isolate 4014 polyprotein gene, complete cds | 5698 | ..................... | 5718 | 100 |
| EF407470.1 | Hepatitis C virus isolate 4064 polyprotein gene, complete cds | 5706 | ..................... | 5726 | 100 |
| EF407476.1 | Hepatitis C virus isolate 3012 polyprotein gene, complete cds | 5689 | ..................... | 5709 | 100 |
| EU155224.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V152/2003, complet | 5702 | ..................... | 5722 | 100 |
| EU155231.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V163/2002, complet | 5702 | ..................... | 5722 | 100 |
| EU482874.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V287/2005, complet | 5705 | ..................... | 5725 | 100 |
| EU155253.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V363/2006, complet | 5705 | ..................... | 5725 | 100 |
| EU155254.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V365/2006, complet | 5703 | ..................... | 5723 | 100 |
| EU155258.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V371/2006, complet | 5702 | ..................... | 5722 | 100 |
| EU155263.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V384/2005, complet | 5702 | ..................... | 5722 | 100 |
| EU155281.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V512/2005, complet | 5702 | ..................... | 5722 | 100 |
| EU155305.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V350/2002, complet | 5702 | ..................... | 5722 | 100 |
| EU155324.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V121/1992, complet | 5702 | ..................... | 5722 | 100 |
| EU155328.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V127/1992, complet | 5702 | ..................... | 5722 | 100 |
| EU155332.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V132/1996, complet | 5702 | ..................... | 5722 | 100 |
| EU155357.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V275/2003, complet | 5702 | ..................... | 5722 | 100 |
| EU155372.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V306/2004, complet | 5702 | ..................... | 5722 | 100 |
| EU155373.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V307/2005, complet | 5702 | ..................... | 5722 | 100 |
| EU256089.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V161/2002, complet | 5702 | ..................... | 5722 | 100 |
| EU256079.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V286/2005, complet | 5703 | ..................... | 5723 | 100 |
| EU256080.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V292/2002, complet | 5702 | ..................... | 5722 | 100 |
| EU255961.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V137/1991, complet | 5703 | ..................... | 5723 | 100 |
| D90208.1 | HPCJCG Hepatitis C virus ORF gene, complete cds | 5743 | _.................... | 5762 | 95 |
| U01214.1 | HCU01214 Hepatitis C virus subtype 1b strain HCV-L2, complete genome | 5756 | _.................... | 5775 | 95 |
| D30613.1 | HPCPP Hepatitis C virus complete genome sequence | 5755 | _.................... | 5774 | 95 |
| D63857.1 | HPVHCVN Hepatitis C virus gene for E1 and E2/NS1 envelope glycoprotein | 5662 | _.................... | 5681 | 95 |
| D45172.1 | HPCHCPO Hepatitis C virus genomic RNA for HCV polyprotein, complete cd | 5755 | _.................... | 5774 | 95 |
| D89815.1 | Hepatitis C virus genomic RNA, complete sequence | 5755 | _.................... | 5774 | 95 |
| AF207754.1 | Hepatitis C virus subtype 1b strain MD13, complete genome | 5743 | _.................... | 5762 | 95 |
| AF207767.1 | Hepatitis C virus subtype 1b strain MD26, complete genome | 5743 | _.................... | 5762 | 95 |
| AF207769.1 | Hepatitis C virus subtype 1b strain MD28, complete genome | 5743 | _.................... | 5762 | 95 |
| AF207772.1 | Hepatitis C virus subtype 1b strain MD31, complete genome | 5743 | _.................... | 5762 | 95 |
| AB049098.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT20 | 5724 | _.................... | 5743 | 95 |
| AY587845.1 | Hepatitis C virus strain RF1_2k/1b, N687 polyprotein gene, complete c | 5693 | .........y........... | 5713 | 95 |
| EU155232.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V164/2002, complet | 5704 | _.................... | 5723 | 95 |
| EU482860.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V302/2003, complet | 5703 | _.................... | 5722 | 95 |
| EU155264.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V385/2006, complet | 5681 | _.................... | 5700 | 95 |
| EU155360.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V278/2003, complet | 5703 | _.................... | 5722 | 95 |
| EU256000.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V143/2003, complet | 5703 | _.................... | 5722 | 95 |
| EU857431.1 | Hepatitis C virus subtype 1b isolate Whu, complete genome | 5755 | _.................... | 5774 | 95 |
| AB442219.1 | Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: 1B- | 5755 | _.................... | 5774 | 95 |
| AB442222.1 | Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: 1B- | 5758 | _.................... | 5777 | 95 |
| M96362.1 | HPCUNKCDS Hepatitis C virus mRNA, complete cds | 5755 | .........t........... | 5775 | 95 |
| L02836.1 | HPCCGENOM Hepatitis C virus subtype 1b strain HeBei, complete genome | 5743 | ..c.................. | 5763 | 95 |
| U16362.1 | HCU16362 Hepatitis C virus subtype 1b, complete genome | 5755 | .........t........... | 5775 | 95 |
| AF054248.1 | Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L2S, complete | 5754 | ..c.................. | 5774 | 95 |
| AF165053.1 | Hepatitis C virus subtype 1b strain MD5-1, complete genome | 5742 | .........t........... | 5762 | 95 |
| AF165054.1 | Hepatitis C virus subtype 1b strain MD5-2, complete genome | 5742 | .........t........... | 5762 | 95 |
| AF207760.1 | Hepatitis C virus subtype 1b strain MD19, complete genome | 5742 | ..c.................. | 5762 | 95 |
| AF207761.1 | Hepatitis C virus subtype 1b strain MD20, complete genome | 5742 | ..c.................. | 5762 | 95 |
| AF207768.1 | Hepatitis C virus subtype 1b strain MD27, complete genome | 5742 | .........t........... | 5762 | 95 |
| AB049087.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT05 | 5723 | .........t........... | 5743 | 95 |
| AB049090.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT14 | 5723 | ..............c...... | 5743 | 95 |
| AB049096.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT19 | 5723 | .........t........... | 5743 | 95 |
| AF356827.1 | Hepatitis C virus subtype 1b isolate HCV-S1, complete genome | 5754 | ..c.................. | 5774 | 95 |
| AB154179.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 5742 | ..............c...... | 5762 | 95 |
| AB154180.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 5742 | ..............c...... | 5762 | 95 |
| AB154182.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 5742 | ..............c...... | 5762 | 95 |
| AB154185.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 5742 | ..............c...... | 5762 | 95 |
| AB154186.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 5742 | ..............c...... | 5762 | 95 |
| AB154192.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 5742 | ..............c...... | 5762 | 95 |
| AB154194.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 5742 | ..............c...... | 5762 | 95 |
| AB191333.1 | Hepatitis C virus genomic RNA, complete genome, strain:0 | 5754 | .........t........... | 5774 | 95 |
| EF032892.1 | Hepatitis C virus subtype 1b isolate BR1427_P1_10.7.03 polyprotein ge | 5730 | ..c.................. | 5750 | 95 |
| EF032893.1 | Hepatitis C virus subtype 1b isolate BR1427_P3_11.10.03 polyprotein g | 5728 | ..c.................. | 5748 | 95 |
| EF407461.1 | Hepatitis C virus isolate 5004 polyprotein gene, complete cds | 5734 | ..c.................. | 5754 | 95 |
| EF407487.1 | Hepatitis C virus isolate 6057 polyprotein gene, complete cds | 5701 | ..a.................. | 5721 | 95 |
| EF407493.1 | Hepatitis C virus isolate 3031 polyprotein gene, complete cds | 5709 | ..c.................. | 5729 | 95 |
| EU234061.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V126/1991, complet | 5702 | ..c.................. | 5722 | 95 |
| EU234062.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V135/1992, complet | 5702 | ..............c...... | 5722 | 95 |
| EU155218.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V145/2005, complet | 5703 | ..............c...... | 5723 | 95 |
| EU155219.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V146/2002, complet | 5702 | ..c.................. | 5722 | 95 |
| EU155225.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V155/2003, complet | 5703 | ..............c...... | 5723 | 95 |
| EU155226.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V156/2004, complet | 5702 | ..c.................. | 5722 | 95 |
| EU482833.1 | Hepatitis C virus subtype 1b isolate HCV-1b/DE/BID-V503/2003, complet | 5702 | ..c.................. | 5722 | 95 |
| EU482849.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V138/1989, complet | 5702 | ..............c...... | 5722 | 95 |
| EU482877.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V342/2001, complet | 5708 | ..c.................. | 5728 | 95 |
| EU482880.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V373/2006, complet | 5705 | ..c.................. | 5725 | 95 |
| EU482883.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V153/2005, complet | 5708 | ..............c...... | 5728 | 95 |
| EU482885.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V448/2006, complet | 5705 | ..c.................. | 5725 | 95 |
| EU482886.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V458/2006, complet | 5706 | ..g.................. | 5726 | 95 |
| EU482888.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V123/1992, complet | 5705 | .................t... | 5725 | 95 |
| EU155255.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V366/2006, complet | 5708 | ..............c...... | 5728 | 95 |
| EU155259.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V374/2006, complet | 5702 | ..c.................. | 5722 | 95 |
| EU155260.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V375/2006, complet | 5702 | ........t............ | 5722 | 95 |
| EU155304.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V347/2003, complet | 5431 | ........g............ | 5451 | 95 |
| EU155316.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V419/2002, complet | 5702 | ........a............ | 5722 | 95 |
| EU155326.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V124/1992, complet | 5702 | ..c.................. | 5722 | 95 |
| EU155329.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V128/1992, complet | 5702 | ..c.................. | 5722 | 95 |
| EU155333.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V133/1989, complet | 5691 | ..c.................. | 5711 | 95 |
| EU155361.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V281/2004, complet | 5702 | ..c.................. | 5722 | 95 |
| EU155366.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V294/2002, complet | 5702 | ..c.................. | 5722 | 95 |
| EU155371.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V301/2005, complet | 5699 | .........t........... | 5719 | 95 |
| EU660386.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V355/2006, complet | 5702 | ...........a......... | 5722 | 95 |
| EU660388.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V154/2001, complet | 5703 | ..g.................. | 5723 | 95 |
| AB429050.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: AH1 | 5754 | ........g............ | 5774 | 95 |
| EU256059.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V220/2005, complet | 5702 | .....t............... | 5722 | 95 |
| EU256102.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V415/2001, complet | 5702 | ..c.................. | 5722 | 95 |
| EU256001.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V144/2002, complet | 5702 | ..c.................. | 5722 | 95 |
| EU256077.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V283/2005, complet | 5702 | ...........a......... | 5722 | 95 |
| EU256083.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V299/2005, complet | 5702 | ..............c...... | 5722 | 95 |
| EU255962.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V140/1991, complet | 5420 | ..............c...... | 5440 | 95 |
| FJ024086.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1704/2007, comple | 5702 | ..c.................. | 5722 | 95 |
| FJ024279.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1715/2007, comple | 5702 | ..c.................. | 5722 | 95 |
| AB442220.1 | Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: KAH | 5754 | .........t........... | 5774 | 95 |
| FN435993.1 | Hepatitis C virus subtype 1b complete genome, isolate EU1, genomic RN | 5755 | ..c.................. | 5775 | 95 |
| GU133617.1 | Hepatitis C virus subtype 1b, complete genome | 5754 | ..c.................. | 5774 | 95 |
| M58335.1 | HPCHUMR Hepatitis C virus subtype 1b, complete genome | 5747 | __................... | 5765 | 90 |
| D14484.1 | HPCJRNA Hepatitis C virus strain J33 genomic RNA, complete genome | 5756 | __................... | 5774 | 90 |
| AF208024.1 | Hepatitis C virus subtype 1b strain MD34, complete genome | 5738 | __................... | 5756 | 90 |
| AF207753.1 | Hepatitis C virus subtype 1b strain MD12, complete genome | 5744 | __................... | 5762 | 90 |
| AF207763.1 | Hepatitis C virus subtype 1b strain MD22, complete genome | 5744 | __................... | 5762 | 90 |
| AB049088.1 | Hepatitis C virus genomic RNA, complete genome, isolate: HCVT094 | 5756 | __................... | 5774 | 90 |
| AB049091.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT14 | 5674 | __................... | 5692 | 90 |
| AB049093.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT15 | 5725 | __................... | 5743 | 90 |
| AB049099.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT21 | 5759 | __................... | 5777 | 90 |
| AF333324.1 | Hepatitis C virus type 1b polyprotein mRNA, complete cds | 5756 | __................... | 5774 | 90 |
| AB080299.1 | Hepatitis C virus genomic RNA, complete genome, isolate:M1LE | 5756 | __................... | 5774 | 90 |
| EF407471.1 | Hepatitis C virus isolate 5044 polyprotein gene, complete cds | 5701 | __................... | 5719 | 90 |
| EF407482.1 | Hepatitis C virus isolate 6053 polyprotein gene, complete cds | 5641 | __................... | 5659 | 90 |
| EF407488.1 | Hepatitis C virus isolate 8016 polyprotein gene, complete cds | 5700 | __................... | 5718 | 90 |
| EF407497.1 | Hepatitis C virus isolate 5002 polyprotein gene, complete cds | 5700 | __................... | 5718 | 90 |
| EU239714.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V417/2001, complet | 5705 | __................... | 5723 | 90 |
| EU155279.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V441/2001, complet | 5704 | __................... | 5722 | 90 |
| EU155301.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V344/2001, complet | 5704 | __................... | 5722 | 90 |
| EU155325.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V122/1991, complet | 5704 | __................... | 5722 | 90 |
| EU256101.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V351/2002, complet | 5704 | __................... | 5722 | 90 |
| EU256103.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V418/2001, complet | 5701 | __................... | 5719 | 90 |
| AB442221.1 | Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: KAH | 5756 | __................... | 5774 | 90 |
| D13558.1 | HPCJ483 Hepatitis C virus genome, complete sequence | 5755 | _.c.................. | 5774 | 90 |
| D10750.1 | HPCJ491 Hepatitis C virus genome, complete sequence | 5755 | _.c.................. | 5774 | 90 |
| D11168.1 | HPCJTA Hepatitis C virus (HCV) complete genome | 5755 | _.............c...... | 5774 | 90 |
| D11355.1 | HPCJTB Hepatitis C virus genomic RNA, complete genome, strain: JT' | 5755 | _.............c...... | 5774 | 90 |
| S62220.1 | Hepatitis C virus subtype 1b, complete genome | 5754 | _.c.................. | 5773 | 90 |
| AF054247.1 | Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L6S, complete | 5755 | _.c.................. | 5774 | 90 |
| AF054249.1 | Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L4S, complete | 5756 | _.c.................. | 5775 | 90 |
| AF054250.1 | Hepatitis C virus subtype 1b strain HC-J4, complete genome | 5745 | _.c.................. | 5764 | 90 |
| AF165049.1 | Hepatitis C virus subtype 1b strain MD3-1, complete genome | 5743 | _..........a......... | 5762 | 90 |
| AF165050.1 | Hepatitis C virus subtype 1b strain MD3-2, complete genome | 5743 | _..........a......... | 5762 | 90 |
| AF165061.1 | Hepatitis C virus subtype 1b strain MD9-1, complete genome | 5743 | _..........a......... | 5762 | 90 |
| AF165062.1 | Hepatitis C virus subtype 1b strain MD9-2, complete genome | 5743 | _..........a......... | 5762 | 90 |
| AF207757.1 | Hepatitis C virus subtype 1b strain MD16, complete genome | 5743 | _........t........... | 5762 | 90 |
| AF207758.1 | Hepatitis C virus subtype 1b strain MD17, complete genome | 5743 | _..........t......... | 5762 | 90 |
| AB049092.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT14 | 5724 | _........a........... | 5743 | 90 |
| AB049097.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT19 | 5724 | _.............c...... | 5743 | 90 |
| AF139594.2 | Hepatitis C virus subtype 1b strain HCV-N, complete genome | 5758 | _.c.................. | 5777 | 90 |
| AB154183.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 5742 | ..............c....._ | 5761 | 90 |
| AB154187.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 5742 | ..............c....._ | 5761 | 90 |
| AB154189.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 5742 | ..............c....._ | 5761 | 90 |
| AB154190.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 5742 | ..............c....._ | 5761 | 90 |
| AB154191.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 5742 | ..............c....._ | 5761 | 90 |
| AB154198.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 5742 | ..............c....._ | 5761 | 90 |
| AB154201.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 5742 | ..............c....._ | 5761 | 90 |
| AB154202.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 5742 | ..............c....._ | 5761 | 90 |
| AB154203.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 5742 | ..............c....._ | 5761 | 90 |
| AB154204.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 5742 | ..............c....._ | 5761 | 90 |
| AB154205.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 5742 | ..............c....._ | 5761 | 90 |
| AB154206.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 5742 | ..............c....._ | 5761 | 90 |
| EU155217.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V142/2004, complet | 5703 | _.c.................. | 5722 | 90 |
| EU155257.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V369/2006, complet | 5703 | _.c.................. | 5722 | 90 |
| EU155280.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V442/2001, complet | 5703 | _.c.................. | 5722 | 90 |
| EU155315.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V416/2001, complet | 5703 | _....t............... | 5722 | 90 |
| EU155317.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V420/2002, complet | 5703 | _.c.................. | 5722 | 90 |
| EU155336.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V139/1992, complet | 5703 | _.c.................. | 5722 | 90 |
| EU155377.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V313/2006, complet | 5703 | _..........t......... | 5722 | 90 |
| EU155382.2 | Hepatitis C virus subtype 1b isolate HCV-1b/DE/BID-V504/2003, complet | 5709 | _..........t......... | 5728 | 90 |
| EU256090.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V162/2002, complet | 5703 | _.c.................. | 5722 | 90 |
| EU256099.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V348/2002, complet | 5703 | _.c.................. | 5722 | 90 |
| FJ478453.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V2148/1999, comple | 5703 | _.c.................. | 5722 | 90 |
| EU862837.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V304/2004, complet | 5709 | ..............c....._ | 5728 | 90 |
| M84754.1 | HPCGENANTI Hepatitis C virus subtype 1b strain Taiwan, complete genome | 5757 | ___.................. | 5774 | 85 |
| AF207756.1 | Hepatitis C virus subtype 1b strain MD15, complete genome | 5745 | ___.................. | 5762 | 85 |
| AF207766.1 | Hepatitis C virus subtype 1b strain MD25, complete genome | 5745 | ___.................. | 5762 | 85 |
| AB049101.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT22 | 5726 | ___.................. | 5743 | 85 |
| EU155222.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V150/2004, complet | 5705 | ___.................. | 5722 | 85 |
| EU155223.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V151/2002, complet | 5711 | ___.................. | 5728 | 85 |
| EU155228.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V158/2003, complet | 5705 | ___.................. | 5722 | 85 |
| EU482879.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V372/2006, complet | 5708 | ___.................. | 5725 | 85 |
| EU155331.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V131/1990, complet | 5705 | ___.................. | 5722 | 85 |
| EU155356.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V273/2003, complet | 5705 | ___.................. | 5722 | 85 |
| EU155365.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V289/2006, complet | 5705 | ___.................. | 5722 | 85 |
| EU155367.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V295/2002, complet | 5705 | ___.................. | 5722 | 85 |
| EU529682.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V291/2002, complet | 5423 | ___.................. | 5440 | 85 |
| EU256062.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V368/2006, complet | 5708 | ___.................. | 5725 | 85 |
| EU256064.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V376/2006, complet | 5705 | ___.................. | 5722 | 85 |
| EU862835.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V509/2001, partial | 5702 | ___.................. | 5719 | 85 |
| FJ390397.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1749/2008, comple | 5705 | ___.................. | 5722 | 85 |
| D14853.1 | HPCCGS Hepatitis C virus (isolate HC-G9) genomic RNA, complete genome | 5754 | ..a........c......... | 5774 | 90 |
| D50481.1 | HPCK1R2 Hepatitis C virus (strain HCV-1b, clone HCV-K1-R2), complete g | 5742 | ..c..............t... | 5762 | 90 |
| U89019.1 | HCU89019 Hepatitis C virus subtype 1b, complete genome | 5746 | ..a......t........... | 5766 | 90 |
| AF165045.1 | Hepatitis C virus subtype 1b strain MD1-1, complete genome | 5742 | ..c........a......... | 5762 | 90 |
| AF165046.1 | Hepatitis C virus subtype 1b strain MD1-2, complete genome | 5742 | ..c........a......... | 5762 | 90 |
| AF165047.1 | Hepatitis C virus subtype 1b strain MD2-1, complete genome | 5742 | .........t....c...... | 5762 | 90 |
| AF165048.1 | Hepatitis C virus subtype 1b strain MD2-2, complete genome | 5742 | .........t....c...... | 5762 | 90 |
| AF207755.1 | Hepatitis C virus subtype 1b strain MD14, complete genome | 5742 | ..c........a......... | 5762 | 90 |
| AF207773.1 | Hepatitis C virus subtype 1b strain MD32, complete genome | 5742 | ........tt........... | 5762 | 90 |
| AB049089.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT10 | 5723 | .........t....c...... | 5743 | 90 |
| AB049094.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT16 | 5758 | .........t.......t... | 5778 | 90 |
| AF483269.1 | Hepatitis C virus type 1b isolate HCV-TR1 from Turkey, complete genom | 5719 | ..c..............t... | 5739 | 90 |
| AY651061.1 | Hepatitis C virus isolate Khaja1, complete genome | 5754 | ..g........c......... | 5774 | 90 |
| AB154199.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 5742 | ..c...........c...... | 5762 | 90 |
| AB154200.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 5742 | ..c...........c...... | 5762 | 90 |
| DQ071885.1 | Hepatitis C virus subtype 1b polyprotein mRNA, complete cds | 5754 | ..a......t........... | 5774 | 90 |
| DQ418785.1 | Hepatitis C virus isolate 02Q polyprotein gene, partial cds | 5675 | ..a........t......... | 5695 | 90 |
| DQ418787.1 | Hepatitis C virus subtype 4a isolate F753 polyprotein gene, complete | 5675 | ..g........t......... | 5695 | 90 |
| DQ418789.1 | Hepatitis C virus subtype 4a isolate L835 polyprotein gene, complete | 5674 | ..a.....t............ | 5694 | 90 |
| DQ988079.1 | Hepatitis C virus isolate Eg12 polyprotein gene, partial cds | 5672 | ..a........t......... | 5692 | 90 |
| EF407475.1 | Hepatitis C virus isolate 3009 polyprotein gene, complete cds | 5686 | ...........a..c...... | 5706 | 90 |
| EF407480.1 | Hepatitis C virus isolate 3043 polyprotein gene, complete cds | 5701 | ..c..t............... | 5721 | 90 |
| EU362895.1 | Hepatitis C virus isolate 7043_FU24 polyprotein (pol) gene, complete | 5672 | ..a........c......... | 5692 | 90 |
| EU155221.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V148/2004, complet | 5702 | ..c...........c...... | 5722 | 90 |
| EU155230.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V160/2002, complet | 5702 | ..c..............t... | 5722 | 90 |
| EU482839.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V370/2006, complet | 5702 | ..c.....t............ | 5722 | 90 |
| EU155261.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V379/2005, complet | 5703 | ..c......t........... | 5723 | 90 |
| EU155272.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V404/2006, complet | 5650 | ..a........t......... | 5670 | 90 |
| EU155283.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V698/2006, complet | 5687 | ..a........c......... | 5707 | 90 |
| EU155318.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V421/2005, complet | 5702 | ..c.....t............ | 5722 | 90 |
| EU155330.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V130/1994, complet | 5724 | ..c...........c...... | 5744 | 90 |
| EU155358.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V276/2004, complet | 5702 | ..a.....t............ | 5722 | 90 |
| EU155359.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V277/2002, complet | 5703 | ..c...........c...... | 5723 | 90 |
| EU155363.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V285/2005, complet | 5702 | ..c..t............... | 5722 | 90 |
| EU155368.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V296/2001, complet | 5702 | ..c...........c...... | 5722 | 90 |
| EU155370.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V300/2005, complet | 5702 | .....t...t........... | 5722 | 90 |
| EU155375.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V309/2006, complet | 5702 | ..c.....g............ | 5722 | 90 |
| EU660384.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V55/2005, complete | 5702 | ..a........c......... | 5722 | 90 |
| EU256066.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V382/2003, complet | 5703 | ..c...........c...... | 5723 | 90 |
| EU256098.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V343/2002, complet | 5717 | ..c...........c...... | 5737 | 90 |
| EU256055.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V6/2001, complete | 5676 | ..a........c......... | 5696 | 90 |
| EU256075.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V279/2004, complet | 5702 | ..c.....t............ | 5722 | 90 |
| EU256081.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V293/2002, complet | 5702 | ..c..t............... | 5722 | 90 |
| EU256082.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V298/2005, complet | 5703 | ..c...........c...... | 5723 | 90 |
| FJ462431.1 | Hepatitis C virus isolate QC139, complete genome | 5753 | ..a........c......... | 5773 | 90 |
| FJ462440.1 | Hepatitis C virus isolate QC93, complete genome | 5754 | ..a........t......... | 5774 | 90 |
| FJ462441.1 | Hepatitis C virus isolate QC97, complete genome | 5756 | ..a........a......... | 5776 | 90 |
| EU862831.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V400/2006, complet | 5672 | ..a........c......... | 5692 | 90 |
| Y11604.1 | Hepatitis C virus type 4a RNA for HCV polyprotein | 5692 | ..a........t......... | 5712 | 90 |
| U45476.1 | HCU45476 Hepatitis C virus isolate HD-1, complete genome | 5756 | __.............g..... | 5774 | 85 |
| D85516.1 | Hepatitis C virus genomic RNA, complete cds | 5756 | __.........a......... | 5774 | 85 |
| AF165051.1 | Hepatitis C virus subtype 1b strain MD4-1, complete genome | 5744 | __......t............ | 5762 | 85 |
| AF165052.1 | Hepatitis C virus subtype 1b strain MD4-2, complete genome | 5744 | __......t............ | 5762 | 85 |
| AF165057.1 | Hepatitis C virus subtype 1b strain MD7-1, complete genome | 5744 | __.........a......... | 5762 | 85 |
| AF165058.1 | Hepatitis C virus subtype 1b strain MD7-2, complete genome | 5744 | __.........a......... | 5762 | 85 |
| AF207762.1 | Hepatitis C virus subtype 1b strain MD21, complete genome | 5744 | __.........a......... | 5762 | 85 |
| AF207765.1 | Hepatitis C virus subtype 1b strain MD24, complete genome | 5744 | __.........a......... | 5762 | 85 |
| AF207770.1 | Hepatitis C virus subtype 1b strain MD29, complete genome | 5744 | __.........a......... | 5762 | 85 |
| AF207774.1 | Hepatitis C virus subtype 1b strain MD33, complete genome | 5744 | __............c...... | 5762 | 85 |
| AB049100.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT21 | 5725 | __............c...... | 5743 | 85 |
| AY587844.1 | Hepatitis C virus strain N589 polyprotein gene, complete cds | 5704 | __.......t........... | 5722 | 85 |
| AB154177.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 5744 | __............c...... | 5762 | 85 |
| AB249644.1 | Hepatitis C virus subtype 1b genomic RNA, complete genome, hiroshima | 5756 | __......t............ | 5774 | 85 |
| EF638081.1 | Hepatitis C virus subtype 1b from Hubei, complete genome | 5712 | __...............t... | 5730 | 85 |
| EF407479.1 | Hepatitis C virus isolate 4036 polyprotein gene, complete cds | 5707 | __............c...... | 5725 | 85 |
| EF407483.1 | Hepatitis C virus isolate 4043 polyprotein gene, complete cds | 5731 | __............a...... | 5749 | 85 |
| EF407492.1 | Hepatitis C virus isolate 7025 polyprotein gene, complete cds | 5696 | __.........a......... | 5714 | 85 |
| EF407501.1 | Hepatitis C virus isolate 7055 polyprotein gene, complete cds | 5729 | __..........c........ | 5747 | 85 |
| EF407503.1 | Hepatitis C virus isolate 5083 polyprotein gene, complete cds | 5703 | __.......t........... | 5721 | 85 |
| EU155220.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V147/2004, complet | 5690 | __............a...... | 5708 | 85 |
| EU155235.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V449/2006, complet | 5704 | __..........c........ | 5722 | 85 |
| EU155300.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V341/2003, complet | 5703 | __.........a......... | 5721 | 85 |
| EU155302.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V345/2001, complet | 5704 | __............c...... | 5722 | 85 |
| EU155303.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V346/2001, complet | 5704 | __.........a......... | 5722 | 85 |
| EU155334.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V134/1990, complet | 5704 | __.........a......... | 5722 | 85 |
| EU155337.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V141/1990, complet | 5704 | __............c...... | 5722 | 85 |
| EU155362.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V282/2004, complet | 5704 | __.........t......... | 5722 | 85 |
| EU155369.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V297/2002, complet | 5704 | __..........c........ | 5722 | 85 |
| AB426117.1 | Hepatitis C virus subtype 1b genomic RNA, complete genome, hiroshima | 5756 | __......t............ | 5774 | 85 |
| AB435162.2 | Hepatitis C virus subtype 1b genomic RNA, complete genome, hiroshima | 5756 | __......t............ | 5774 | 85 |
| EU256061.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V364/2006, complet | 5704 | __............c...... | 5722 | 85 |
| EU256045.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V380/2003, complet | 5704 | __............c...... | 5722 | 85 |
| FJ024277.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1711/2007, comple | 5704 | __...............t... | 5722 | 85 |
| FJ821465.1 | Hepatitis C virus strain M21-2k/1b, complete genome | 5742 | __..........c........ | 5760 | 85 |
| D89872.1 | Hepatitis C virus RNA for polyprotein, complete cds | 5414 | _..........a..c...... | 5433 | 85 |
| AF176573.1 | Hepatitis C virus subtype 1b strain 274933RU, complete genome | 5755 | _.c.....t............ | 5774 | 85 |
| AF165063.1 | Hepatitis C virus subtype 1b strain MD10-1, complete genome | 5743 | _.c........t......... | 5762 | 85 |
| AF165064.1 | Hepatitis C virus subtype 1b strain MD10-2, complete genome | 5743 | _.c........t......... | 5762 | 85 |
| AF207759.1 | Hepatitis C virus subtype 1b strain MD18, complete genome | 5743 | _....t.....a......... | 5762 | 85 |
| AB154181.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 5742 | ..g...........c....._ | 5761 | 85 |
| DQ418784.1 | Hepatitis C virus subtype 4a isolate 02C polyprotein gene, complete c | 5677 | ..a.....t..k......... | 5697 | 85 |
| DQ988077.1 | Hepatitis C virus isolate Eg9 polyprotein gene, partial cds | 5673 | ..g........t..y...... | 5693 | 85 |
| EU482875.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V310/2005, complet | 5703 | _.c......t........... | 5722 | 85 |
| EU155256.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V367/2006, complet | 5703 | _.c......t........... | 5722 | 85 |
| FJ025855.1 | Hepatitis C virus strain P212 polyprotein gene, complete cds | 5603 | ..g........r..c...... | 5623 | 85 |
| D10934.1 | HPCRNA Hepatitis C virus RNA, complete genome sequence | 5757 | ___...........c...... | 5774 | 80 |
| D50483.1 | HPCK1S1 Hepatitis C virus (strain HCV-1b, clone HCV-K1-S1), complete g | 5745 | ___...........c...... | 5762 | 80 |
| D50480.1 | HPCK1R1 Hepatitis C virus (strain HCV-1b, clone HCV-K1-R1), complete g | 5745 | ___...........c...... | 5762 | 80 |
| AY460204.1 | Hepatitis C virus from Shanghai, complete genome | 5757 | ___..............t... | 5774 | 80 |
| AB154178.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 5744 | __............c....._ | 5761 | 80 |
| EF407460.1 | Hepatitis C virus isolate 8007 polyprotein gene, complete cds | 5707 | ___.....t............ | 5724 | 80 |
| EF407465.1 | Hepatitis C virus isolate 6017 polyprotein gene, complete cds | 5702 | ___...........g...... | 5719 | 80 |
| EF407472.1 | Hepatitis C virus isolate 4034 polyprotein gene, complete cds | 5703 | ___.........c........ | 5720 | 80 |
| EU155327.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V125/1992, complet | 5695 | ___..t............... | 5712 | 80 |
| EU155381.2 | Hepatitis C virus subtype 1b isolate HCV-1b/DE/BID-V502/2004, complet | 5705 | ___...........c...... | 5722 | 80 |
| EU255960.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V312/2006, complet | 5705 | ___..t............... | 5722 | 80 |
| EU256065.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V377/2006, complet | 5705 | ___...........c...... | 5722 | 80 |
| EU256091.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V455/2006, complet | 5423 | ___.........c........ | 5440 | 80 |
| EU256100.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V349/2002, complet | 5705 | ___...........g...... | 5722 | 80 |
| EU256076.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V280/2004, complet | 5705 | ___..t............... | 5722 | 80 |
| EU256084.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V303/2003, complet | 5711 | ___......t........... | 5728 | 80 |
| EU256085.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V305/2003, complet | 5705 | ___........a......... | 5722 | 80 |
| FJ390396.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1748/2007, comple | 5705 | ___........a......... | 5722 | 80 |
| FJ390398.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1750/2008, comple | 5705 | ___........a......... | 5722 | 80 |
| D50482.1 | HPCK1R3 Hepatitis C virus (strain HCV-1b, clone HCV-K1-R3), complete g | 5742 | ..c.....at........... | 5762 | 85 |
| AY051292.1 | Hepatitis C virus (isolate India) polyprotein mRNA, complete cds | 5754 | ..a......t.c......... | 5774 | 85 |
| DQ516083.1 | Hepatitis C virus subtype 4d isolate 24 polyprotein gene, complete cd | 5689 | ..g..t.....c......... | 5709 | 85 |
| DQ988076.1 | Hepatitis C virus isolate Eg7 polyprotein gene, partial cds | 5669 | ..a..t.....t......... | 5689 | 85 |
| EF407485.1 | Hepatitis C virus isolate 7026 polyprotein gene, complete cds | 5709 | ..c..t.....a......... | 5729 | 85 |
| EU155355.2 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V270/2006, complet | 5678 | ..a..t.....c......... | 5698 | 85 |
| EU256092.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V463/2006, complet | 5702 | ..c..t...t........... | 5722 | 85 |
| FJ462434.1 | Hepatitis C virus isolate QC262, complete genome | 5751 | ..a..t.....a......... | 5771 | 85 |
| AF165059.1 | Hepatitis C virus subtype 1b strain MD8-1, complete genome | 5744 | __......ta........... | 5762 | 80 |
| AF165060.1 | Hepatitis C virus subtype 1b strain MD8-2, complete genome | 5744 | __......ta........... | 5762 | 80 |
| EF407502.1 | Hepatitis C virus isolate 2038 polyprotein gene, complete cds | 5785 | __.........ac........ | 5803 | 80 |
| EF407504.1 | Hepatitis C virus isolate 8069 polyprotein gene, complete cds | 5710 | __.........ac........ | 5728 | 80 |
| EU155335.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V136/1992, complet | 5704 | __.........ac........ | 5722 | 80 |
| EU256088.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V149/2003, complet | 5704 | __.........ac........ | 5722 | 80 |
| AY045702.1 | Hepatitis C virus isolate HCR6, complete genome | 5757 | _.......at.a......... | 5776 | 80 |
| EU155306.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V352/2002, complet | 5703 | _.c.....tt........... | 5722 | 80 |
| D84263.2 | Hepatitis C virus (isolate VN235) genomic RNA, complete genome | 5748 | ___.........c.c...... | 5765 | 76 |
| AY878650.1 | Hepatitis C virus subtype 6k isolate KM45, complete genome | 5743 | ___.........c.c...... | 5760 | 76 |
| AY878651.1 | Hepatitis C virus subtype 6k isolate KM41, complete genome | 5728 | ___.........c.c...... | 5745 | 76 |
| AY878652.1 | Hepatitis C virus subtype 6n isolate KM42, complete genome | 5727 | ___.........c.c...... | 5744 | 76 |
| DQ278891.1 | Hepatitis C virus subtype 6k isolate KM45, complete genome | 5759 | ___.........c.c...... | 5776 | 76 |
| DQ278893.1 | Hepatitis C virus subtype 6k isolate KM41, complete genome | 5760 | ___.........c.c...... | 5777 | 76 |
| DQ278894.1 | Hepatitis C virus subtype 6n isolate KM42, complete genome | 5761 | ___.........c.c...... | 5778 | 76 |
| DQ835768.1 | Hepatitis C virus subtype 6n isolate D86/93, complete genome | 5757 | ___.........c.c...... | 5774 | 76 |
| EU482859.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V272/2003, complet | 5705 | ___.........c.c...... | 5722 | 76 |
| EU482881.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V383/2003, complet | 5714 | ___..t...t........... | 5731 | 76 |
| DQ278892.1 | Hepatitis C virus isolate GZ52557, complete genome | 2341 | ..cc...........tc..c. | 2361 | 76 |