../../tmp/servers/virsirnadb/445283059
Result for your query siRNA sequence
| RED | =100 % Complementary sequence |
| . | =Identical residue |
| blue alphabets | =mismatch |
| _ | =Gap |
| Acc number | Strain name | Start | Alignment | End | % Identity |
| Query | virsi2318 | 1 | cgaggataacgtggataggcc | 21 | |
| AY112987.1 | Semliki forest virus strain L10, complete genome | 8338 | ..................... | 8358 | 100 |
| Z48163.2 | Semliki forest virus genomic RNA for non-structural polyprotein and s | 8319 | ..................... | 8339 | 100 |
| DQ189082.1 | Semliki forest virus isolate ts10 mutant polyprotein nsP1234 and stru | 8255 | ..................... | 8275 | 100 |
| DQ189084.1 | Semliki forest virus isolate ts13 mutant polyprotein nsP1234 and stru | 8255 | ..................... | 8275 | 100 |
| DQ189086.1 | Semliki forest virus polyprotein nsP1234 and structural polyprotein g | 8255 | ..................... | 8275 | 100 |
| EU350586.1 | Semliki forest virus from Viet Nam, complete genome | 8462 | ..................... | 8482 | 100 |
| NC_003215.1 | Semliki forest virus, complete genome | 8337 | ..................... | 8357 | 100 |