../../tmp/servers/virsirnadb/316614584
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi22761ggctgatcaacaccaacggca21
EU155276.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V432/2002, complet1495.....................1515100
FJ182000.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1712/2007, comple1470.....................1490100
D10749.1HPCHCJ1 Hepatitis C virus genomic RNA, complete genome, isolate: HC-J11577_....................159695
M62321.1HPCPLYPRE Hepatitis C virus subtype 1a, complete genome 1577_....................159695
AF271632.1 Hepatitis C virus subtype 1a clone pHCV-1/SF9 A, complete genome 1577_....................159695
AF511949.1 Hepatitis C virus isolate XF223 polyprotein-like gene, complete seque1577_....................159695
AY651061.1 Hepatitis C virus isolate Khaja1, complete genome 1577_....................159695
DQ835763.1 Hepatitis C virus subtype 6m isolate C-0208, complete genome 1571_....................159095
EF032883.1 Hepatitis C virus subtype 1a isolate 03-32_P1_10.16.03 polyprotein ge1499_....................151895
EF032884.1 Hepatitis C virus subtype 1a isolate 03-32_P2_5.14.04 polyprotein gen1478_....................149795
EF032885.1 Hepatitis C virus subtype 1a isolate 03-32_P4_11.5.05 polyprotein gen1498_....................151795
EF407423.1 Hepatitis C virus isolate 8028 polyprotein gene, complete cds 1523_....................154295
EF407425.1 Hepatitis C virus isolate 6071 polyprotein gene, complete cds 1491_....................151095
EF407426.1 Hepatitis C virus isolate 8070 polyprotein genomic sequence 1526_....................154595
EF407431.1 Hepatitis C virus isolate 3005 polyprotein gene, complete cds 1475_....................149495
EF407432.1 Hepatitis C virus isolate 1013 polyprotein gene, complete cds 1538_....................155795
EF407434.1 Hepatitis C virus isolate 2011 polyprotein gene, complete cds 1499_....................151895
EF407436.1 Hepatitis C virus isolate 7040 polyprotein gene, complete cds 1482_....................150195
EF407437.1 Hepatitis C virus isolate 1030 polyprotein gene, complete cds 1537_....................155695
EF407438.1 Hepatitis C virus isolate 7012 polyprotein gene, complete cds 1524_....................154395
EF407439.1 Hepatitis C virus isolate 8003 polyprotein gene, complete cds 1522_....................154195
EF407440.1 Hepatitis C virus isolate 7002 polyprotein gene, complete cds 1525_....................154495
EF407441.1 Hepatitis C virus isolate 1036 polyprotein gene, complete cds 1536_....................155595
EF407442.1 Hepatitis C virus isolate 8012 polyprotein gene, complete cds 1491_....................151095
EF407445.1 Hepatitis C virus isolate 5009 polyprotein gene, complete cds 1498_....................151795
EF407449.1 Hepatitis C virus isolate 2027 polyprotein gene, complete cds 1537_....................155695
EF407451.1 Hepatitis C virus isolate 7041 polyprotein gene, complete cds 1500_....................151995
EF407453.1 Hepatitis C virus isolate 4035 polyprotein gene, complete cds 1524_....................154395
EF407455.1 Hepatitis C virus isolate 7065 polyprotein gene, complete cds 1537_....................155695
EU362878.1 Hepatitis C virus isolate 1030_FU24 polyprotein (pol) gene, partial c1537_....................155695
EU362880.1 Hepatitis C virus isolate 2011_FU24 polyprotein (pol) gene, partial c1498_....................151795
EU362881.1 Hepatitis C virus isolate 2027_FU24 polyprotein (pol) gene, partial c1538_....................155795
EU362882.1 Hepatitis C virus isolate 3005_FU24 polyprotein (pol) gene, complete 1496_....................151595
EU362884.1 Hepatitis C virus isolate 4035_FU24 polyprotein (pol) gene, complete 1539_....................155895
EU362890.1 Hepatitis C virus isolate 7002_FU24 polyprotein (pol) gene, partial c1536_....................155595
EU362892.1 Hepatitis C virus isolate 7012_FU24 polyprotein (pol) gene, complete 1522_....................154195
EU362893.1 Hepatitis C virus isolate 7040_FU24 polyprotein (pol) gene, complete 1485_....................150495
EU362894.1 Hepatitis C virus isolate 7041_FU24 polyprotein (pol) gene, partial c1474_....................149395
EU362897.1 Hepatitis C virus isolate 7065_FU24 polyprotein (pol) gene, complete 1536_....................155595
EU362899.1 Hepatitis C virus isolate 1013q polyprotein (pol) gene, partial cds 1538_....................155795
EU362900.1 Hepatitis C virus isolate 1030q polyprotein (pol) gene, partial cds 1537_....................155695
EU362901.1 Hepatitis C virus isolate 2011q polyprotein (pol) gene, complete cds 1499_....................151895
EU362902.1 Hepatitis C virus isolate 2027q polyprotein (pol) gene, partial cds 1537_....................155695
EU362907.1 Hepatitis C virus isolate 7002q polyprotein (pol) gene, complete cds 1525_....................154495
EU239713.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V316/2001, complet1525_....................154495
EU234064.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V182/1990, complet1491_....................151095
EU155214.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V104/2005, complet1503_....................152295
EU155216.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V115/2001, complet1497_....................151695
EU155236.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V450/2006, complet1468_....................148795
EU155240.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V68/2004, complete1495_....................151495
EU482831.1 Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V25/2003, complete1483_....................150295
EU482834.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V422/2002, complet1459_....................147895
EU482835.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V427/2002, complet1510_....................152995
EU482841.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V387/2004, complet1510_....................152995
EU482844.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V436/2006, complet1511_....................153095
EU482850.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V186/1990, complet1472_....................149195
EU482852.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V217/1989, complet1494_....................151395
EU482854.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V242/2001, complet1494_....................151395
EU482855.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V249/2002, complet1488_....................150795
EU482861.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V446/2006, complet1503_....................152295
EU482865.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V46/2003, complete1483_....................150295
EU482866.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V460/2006, complet1510_....................152995
EU482867.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V461/2006, complet1510_....................152995
EU482870.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V75/2004, complete1518_....................153795
EU482871.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V77/2002, complete1486_....................150595
EU482872.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V261/2004, complet1509_....................152895
EU482876.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V330/2002, complet1512_....................153195
EU482878.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V19/2004, complete1503_....................152295
EU482887.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V66/2002, complete1473_....................149295
EU482889.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V179/1990, complet1510_....................152995
EU155247.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1/2005, complete 1501_....................152095
EU155248.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V336/2006, complet1495_....................151495
EU155251.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V359/2006, complet1488_....................150795
EU155252.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V362/2006, complet1494_....................151395
EU155265.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V388/2005, complet1497_....................151695
EU155266.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V390/2006, complet1446_....................146595
EU155267.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V391/2006, complet1483_....................150295
EU155268.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V396/2006, complet1472_....................149195
EU155270.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V399/2006, complet1494_....................151395
EU155286.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V319/2001, complet1472_....................149195
EU155287.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V320/2001, complet1532_....................155195
EU155290.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V325/2001, complet1482_....................150195
EU155292.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V327/2001, complet1504_....................152395
EU155298.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V334/2002, complet1507_....................152695
EU155299.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V335/2003, complet1493_....................151295
EU155309.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V356/2003, complet1492_....................151195
EU155312.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V412/2000, complet1485_....................150495
EU155321.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V426/2001, complet1451_....................147095
EU155323.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V429/2002, complet1488_....................150795
EU155340.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V185/1991, complet1472_....................149195
EU155341.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V192/1992, complet1505_....................152495
EU155342.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V197/1989, complet1472_....................149195
EU529681.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V251/2005, complet1493_....................151295
EU569722.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V215/1989, complet1511_....................153095
EU660383.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V100/2004, complet1503_....................152295
EU660384.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V55/2005, complete1525_....................154495
EU687194.1 Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V1563/2004, comple1504_....................152395
EU687195.1 Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V1564/2007, comple1511_....................153095
EU255929.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V233/2004, complet1503_....................152295
EU255931.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V108/2003, complet1503_....................152295
EU255932.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V111/2005, complet1503_....................152295
EU255935.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V462/2007, complet1507_....................152695
EU255938.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V88/2003, complete1509_....................152895
EU255948.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V230/2003, complet1505_....................152495
EU255949.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V235/2005, complet1503_....................152295
EU255951.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V245/2005, complet1509_....................152895
EU255958.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V265/2005, complet1503_....................152295
EU255959.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V268/2003, complet1470_....................148995
EU256060.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V360/2006, complet1497_....................151695
EU256086.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V110/2003, complet1475_....................149495
EU256087.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V114/2001, complet1472_....................149195
EU256095.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V81/2002, complete1507_....................152695
EU256104.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V430/2005, complet1494_....................151395
EU256107.1 Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V36/2004, complete1504_....................152395
EU256002.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V41/2006, complete1518_....................153795
EU256004.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V45/2005, complete1484_....................150395
EU256008.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V47/2002, complete1472_....................149195
EU256011.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V51/2004, complete1472_....................149195
EU256012.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V511/2006, complet1511_....................153095
EU256013.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V53/2004, complete1501_....................152095
EU256015.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V57/2004, complete1495_....................151495
EU256018.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V60/2002, complete1492_....................151195
EU256022.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V65/2003, complete1494_....................151395
EU256025.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V79/2002, complete1473_....................149295
EU256026.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V82/2002, complete1508_....................152795
EU256029.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V85/2001, complete1490_....................150995
EU256030.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V87/2002, complete1486_....................150595
EU256032.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V92/2003, complete1501_....................152095
EU256034.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V95/2006, complete1504_....................152395
EU256035.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V96/2004, complete1503_....................152295
EU256044.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V378/2001, complet1482_....................150195
EU256049.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V395/2006, complet1503_....................152295
EU256050.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V397/2006, complet1504_....................152395
EU256051.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V4/2005, complete 1499_....................151895
EU256070.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V232/2003, complet1496_....................151595
EU255963.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V166/1992, complet1504_....................152395
EU255965.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V168/1990, complet1501_....................152095
EU255966.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V170/1997, complet1508_....................152795
EU255975.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V183/1994, complet1502_....................152195
EU255977.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V187/1991, complet1502_....................152195
EU255978.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V188/1991, complet1491_....................151095
EU255982.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V194/1990, complet1501_....................152095
EU255984.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V200/1990, complet1489_....................150895
EU255988.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V206/1995, complet1493_....................151295
FJ024087.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1705/2007, comple1504_....................152395
FJ024274.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1707/2007, comple1430_....................144995
FJ024276.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1710/2007, comple1469_....................148895
FJ181999.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1706/2007, comple1488_....................150795
FJ205868.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1714/2007, comple1481_....................150095
FJ390394.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1745/2008, comple1487_....................150695
FJ390395.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1747/2008, comple1464_....................148395
EU781804.1 Hepatitis C virus subtype 1a isolate 02-46, complete genome 1492_....................151195
EF407414.1 Hepatitis C virus isolate 7018 polyprotein gene, complete cds 1479.......t.............149995
EF407444.1 Hepatitis C virus isolate 6030 polyprotein gene, complete cds 1497................t....151795
EU155339.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V172/1990, complet1471.......t.............149195
M67463.1HPCCGAA Hepatitis C virus subtype 1a, complete genome 1578__...................159690
AF011751.1 Hepatitis C virus strain H77 pCV-H77C polyprotein gene, complete cds 1578__...................159690
AF011752.1 Hepatitis C virus strain H77 pCV-H11 polyprotein gene, complete cds 1578__...................159690
AF011753.1 Hepatitis C virus strain H77 pH21 polyprotein gene, complete cds 1578__...................159690
AF290978.1 Hepatitis C virus subtype 1a isolate colonel, complete genome 1566__...................158490
EF407424.1 Hepatitis C virus isolate 5069 polyprotein gene, partial cds 1514__...................153290
EU362876.1 Hepatitis C virus isolate 1013_FU24 polyprotein (pol) gene, complete 1537__...................155590
EU363761.1 Recombinant Hepatitis C virus H77C/JFH1, complete genome 1577__...................159590
EU239715.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V423/2003, complet1504__...................152290
EU260396.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V11/2004, complete1481__...................149990
EU482837.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V17/2004, complete1495__...................151390
EU155291.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V326/2002, complet1497__...................151590
EU234065.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V212/1990, complet1473__...................149190
EU529679.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V76/2002, complete1491__...................150990
EU255934.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V453/2006, complet1512__...................153090
EU256003.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V444/2006, complet1511__...................152990
EU256009.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V49/2004, complete1491__...................150990
EU256010.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V50/2002, complete1473__...................149190
EU256036.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V97/2004, complete1504__...................152290
EU256043.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V3/2005, complete 1473__...................149190
EU255969.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V174/1992, complet1500__...................151890
EU255973.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V180/1990, complet1499__...................151790
EU255983.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V195/1990, complet1497__...................151590
EU255985.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V201/1991, complet1507__...................152590
EU255990.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V209/1992, complet1503__...................152190
EU255991.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V210/1989, complet1493__...................151190
FJ024278.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1713/2007, comple1472__...................149090
EU862823.1 Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V24/2003, complete1483__...................150190
AF009606.1 Hepatitis C virus subtype 1a polyprotein gene, complete cds 1578__...................159690
AF207761.1 Hepatitis C virus subtype 1b strain MD20, complete genome 1565_...t................158490
AJ278830.1 Hepatitis C virus genomic RNA for polyprotein gene 1577_...............t....159690
DQ278892.1 Hepatitis C virus isolate GZ52557, complete genome 1575_...t................159490
DQ835766.1 Hepatitis C virus subtype 6m isolate C-0192, complete genome 1571_......t.............159090
DQ835767.1 Hepatitis C virus subtype 6m isolate B4/92, complete genome 1571_......t.............159090
EF424626.1 Hepatitis C virus subtype 6p isolate QC216, complete genome 1575_...............t....159490
EF621489.1 Hepatitis C virus subtype 1a strain HC-TN, complete genome 1577_....g...............159690
EF407411.1 Hepatitis C virus isolate 5043 polyprotein gene, complete cds 1483_...............t....150290
EF407413.1 Hepatitis C virus isolate 5012 polyprotein gene, complete cds 1524_..........t.........154390
EF407418.1 Hepatitis C virus isolate 7020 polyprotein gene, complete cds 1521_...............t....154090
EF407422.1 Hepatitis C virus isolate 6001 polyprotein gene, complete cds 1483_......a.............150290
EF407427.1 Hepatitis C virus isolate 6025 polyprotein gene, complete cds 1524_..........t.........154390
EF407435.1 Hepatitis C virus isolate 5014 polyprotein gene, complete cds 1494_....g...............151390
EF407450.1 Hepatitis C virus isolate 6020 polyprotein gene, complete cds 1495_.........t..........151490
EF407452.1 Hepatitis C virus isolate 2005 polyprotein gene, complete cds 1508_....g...............152790
EF407456.1 Hepatitis C virus isolate 4025 polyprotein gene, complete cds 1536_....g...............155590
EU155294.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V329/2002, complet1471_..........t.........149090
EU260395.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V10/2005, complete1510_...............t....152990
EU362879.1 Hepatitis C virus isolate 2005_FU24 polyprotein (pol) gene, partial c1536_....g...............155590
EU362883.1 Hepatitis C virus isolate 4025_FU24 polyprotein (pol) gene, partial c1536_....g...............155590
EU362886.1 Hepatitis C virus isolate 5014_FU24 polyprotein (pol) gene, complete 1499_....g...............151890
EU362887.1 Hepatitis C virus isolate 6020_FU24 polyprotein (pol) gene, complete 1495_...a................151490
EU362891.1 Hepatitis C virus isolate 7003_FU24 polyprotein (pol) gene, partial c1499_......t.............151890
EU362898.1 Hepatitis C virus isolate 8012_FU24 polyprotein (pol) gene, complete 1481_......t.............150090
EU362903.1 Hepatitis C virus isolate 4025q polyprotein (pol) gene, partial cds 1536_....g...............155590
EU250017.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V508/2001, complet1494_...............t....151390
EU155213.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V101/2004, complet1506_...............t....152590
EU155232.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V164/2002, complet1526_......a.............154590
EU155233.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V445/2006, complet1504_....g...............152390
EU155239.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V54/2004, complete1495_....g...............151490
EU155242.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V73/2004, complete1494_......t.............151390
EU155243.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V86/2005, complete1472_....g...............149190
EU155246.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V93/2003, complete1496_............t.......151590
EU482832.1 Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V33/2004, complete1487_......t.............150690
EU482838.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V361/2006, complet1509_.......g............152890
EU482840.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V386/2004, complet1515_....g...............153490
EU482843.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V435/2005, complet1504_...a................152390
EU482847.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V5/2004, complete 1494_..........t.........151390
EU482853.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V227/2005, complet1496_...a................151590
EU482856.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V250/2002, complet1495_....g...............151490
EU482857.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V263/2005, complet1494_..........t.........151390
EU482858.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V271/2006, complet1501_......t.............152090
EU482862.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V454/2006, complet1503_...............t....152290
EU482864.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V459/2006, complet1510_..........t.........152990
EU482868.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V69/2002, complete1494_.........t..........151390
EU482869.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V70/2002, complete1494_.........t..........151390
EU155250.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V358/2006, complet1502_.t..................152190
EU155254.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V365/2006, complet1526_...t................154590
EU155258.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V371/2006, complet1525_......a.............154490
EU155271.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V401/2006, complet1499_...a................151890
EU155273.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V406/2006, complet1446_......t.............146590
EU155277.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V434/2003, complet1472_..........t.........149190
EU155277.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V434/2003, complet1651___.c.g.t............166871
EU155278.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V437/2006, complet1487_...............t....150690
EU155284.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V317/2001, complet1511_.............g......153090
EU155285.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V318/2001, complet1485_....g...............150490
EU155289.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V323/2001, complet1503_...a................152290
EU155293.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V328/2001, complet1447_..........t.........146690
EU155295.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V331/2002, complet1496_....g...............151590
EU155310.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V357/2004, complet1492_......t.............151190
EU155311.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V411/2003, complet1503_...............t....152290
EU155313.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V413/2003, complet1485_.t..................150490
EU155314.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V414/2004, complet1451_....g...............147090
EU155319.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V424/2002, complet1455_..........t.........147490
EU155322.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V428/2001, complet1491_..........t.........151090
EU155353.2 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V267/2005, complet1495_...............t....151490
EU155355.2 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V270/2006, complet1501_...............t....152090
EU155375.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V309/2006, complet1525_...c................154490
EU155378.2 Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V26/2003, complete1434_...............t....145390
EU529677.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V52/2006, complete1505_....g...............152490
EU529678.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V63/2005, complete1491_....g...............151090
EU529680.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V80/2002, complete1514_......t.............153390
EU595697.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V507/2001, complet1493_....g...............151290
EU595699.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V78/2001, complete1486_............t.......150590
EU660387.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V701/2003, complet1494_......t.............151390
EU255927.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V222/2003, complet1498_...............t....151790
EU255936.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V510/2006, complet1504_............t.......152390
EU255937.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V700/2006, complet1494_....g...............151390
EU255942.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V699/2007, complet1509_....g...............152890
EU255944.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V224/2003, complet1479_....g...............149890
EU255947.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V228/2006, complet1510_...a................152990
EU255950.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V241/2005, complet1495_...a................151490
EU255953.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V248/2006, complet1500_......t.............151990
EU255955.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V254/2002, complet1486_...a................150590
EU255957.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V260/2004, complet1525_...............t....154490
EU256094.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V74/2004, complete1504_......t.............152390
EU256096.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V321/2001, complet1497_...a................151690
EU255994.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V103/2005, complet1487_....g...............150690
EU255995.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V106/2004, complet1502_....g...............152190
EU255997.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V109/2003, complet1474_......t.............149390
EU255998.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V113/2001, complet1504_......t.............152390
EU256006.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V452/2006, complet1511_...a................153090
EU256014.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V56/2004, complete1472_...............t....149190
EU256019.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V61/2001, complete1499_.......c............151890
EU256020.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V62/2003, complete1501_......t.............152090
EU256021.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V64/2003, complete1495_....g...............151490
EU256023.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V67/2003, complete1503_..........t.........152290
EU256024.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V72/2006, complete1472_......a.............149190
EU256031.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V89/2006, complete1501_..............g.....152090
EU256033.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V94/2005, complete1504_....g...............152390
EU256038.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V99/2004, complete1508_..........t.........152790
EU256041.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V2/2005, complete 1508_...a................152790
EU256048.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V394/2006, complet1503_....g...............152290
EU256052.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V403/2006, complet1502_...a................152190
EU256053.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V440/2001, complet1504_.........t..........152390
EU256055.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V6/2001, complete 1499_...............t....151890
EU256056.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V7/2003, complete 1474_...............t....149390
EU256058.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V8/2005, complete 1489_......t.............150890
EU256069.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V229/2006, complet1484_...............t....150390
EU256071.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V234/2004, complet1472_..........t.........149190
EU255964.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V167/1992, complet1487_..............g.....150690
EU255967.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V171/1997, complet1482_....g...............150190
EU255976.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V184/1992, complet1498_....g...............151790
EU255981.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V191/1990, complet1510_....g...............152990
EU255986.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V203/1989, complet1504_....g...............152390
EU255987.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V205/1989, complet1485_..........t.........150490
EU255989.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V208/1990, complet1510_......t.............152990
FJ024275.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1708/2007, comple1469_...............t....148890
FJ024280.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1717/2007, comple1486_............t.......150590
FJ024281.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1718/2007, comple1501_....g...............152090
EU862824.1 Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V31/2004, partial 1494_............t.......151390
FJ205867.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1709/2007, comple1525_......t.............154490
FJ390399.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1751/2007, comple1448_....g...............146790
FJ410172.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1746/2008, comple1471_............t.......149090
AB520610.1 Hepatitis C virus subtype 1a genomic RNA, complete genome, strain: HC1577_...............t....159690
EU862828.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V12/2004, complete1510_...a................152990
EU862840.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V40/2003, complete1518_......t.............153790
EU862841.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V48/2003, complete1492_...............t....151190
HM777359.1 Hepatitis C virus isolate C1292 genotype 2j, complete genome 1496_...c................151590
EU482884.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V38/2004, complete1269___..................128685
EU256028.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V84/2001, complete1505___..................152285
EF407421.1 Hepatitis C virus isolate 8030 polyprotein gene, complete cds 1479...........t.t.......149990
EU362877.1 Hepatitis C virus isolate 1024_FU24 polyprotein (pol) gene, complete 1481.....g.....t.........150190
EU155244.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V90/2005, complete1517....a...........t....153790
EU569723.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V13/2005, complete1495....a.....t..........151590
EU255940.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V433/2006, complet1509....a.....t..........152990
AY587845.1 Hepatitis C virus strain RF1_2k/1b, N687 polyprotein gene, complete c1505__..c................152385
DQ835761.1 Hepatitis C virus subtype 6j isolate C-0667, complete genome 1575__..c................159385
DQ835769.1 Hepatitis C virus subtype 6j isolate Th553, complete genome 1575__..c................159385
EF407417.1 Hepatitis C virus isolate 4040 polyprotein gene, complete cds 1537__.....t.............155585
EU155296.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V332/2002, complet1494__...g...............151285
EU155320.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V425/2001, complet1449__.................t.146785
EU155338.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V169/1996, complet1496__...g...............151485
EU155343.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V214/1996, complet1497__.............g.....151585
EU256097.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V324/2001, complet1504__..............t....152285
EU255999.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V116/2002, complet1491__.........t.........150985
EU256039.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V16/2004, complete1497__...g...............151585
EU256047.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V393/2006, complet1504__...g...............152285
EU255979.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V189/1991, complet1505__.................t.152385
FJ182001.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1716/2007, comple1496__...g...............151485
EU781823.1 Hepatitis C virus subtype 1a isolate 03-12, complete genome 1501__...g...............151985
FJ821465.1 Hepatitis C virus strain M21-2k/1b, complete genome 1552__..c................157085
EU862839.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V175/1990, complet1506__.........t.........152485
FN666428.2 Hepatitis C virus gene for polyprotein, genomic RNA, subtype 2q, isol1550__..c................156885
D00944.1HPCPOLP Hepatitis C virus genomic RNA for polyprotein, complete cds 1576_...c...........t....159585
M96362.1HPCUNKCDS Hepatitis C virus mRNA, complete cds 1578_...c..a.............159785
U16362.1HCU16362 Hepatitis C virus subtype 1b, complete genome 1578_...c..a.............159785
D63857.1HPVHCVN Hepatitis C virus gene for E1 and E2/NS1 envelope glycoprotein1484_...t..a.............150385
D50483.1HPCK1S1 Hepatitis C virus (strain HCV-1b, clone HCV-K1-S1), complete g1565_...t..t.............158485
D50480.1HPCK1R1 Hepatitis C virus (strain HCV-1b, clone HCV-K1-R1), complete g1565_...t..a.............158485
D63822.1HPCJK046E2 Hepatitis C virus (isolate JK046) genomic RNA, complete gen1571_...t..............a.159085
AJ132996.1 Hepatitis C virus, complete genome, isolate HCV-AD78 1582_...t..a.............160185
AJ132997.1 Hepatitis C virus, complete genome, isolate HCV-AD78P1 1576_...t..a.............159585
AF238481.1 Hepatitis C virus subtype 2a strain MD2a-1, complete genome 1542_...c...........t....156185
AF238483.1 Hepatitis C virus subtype 2a strain MD2a-4, complete genome 1542_...c...........t....156185
AF238484.1 Hepatitis C virus subtype 2a strain MD2a-5, complete genome 1542_...c...........t....156185
AB047639.1 Hepatitis C virus (isolate JFH-1) genomic RNA, complete genome 1576_...c..t.............159585
AF356827.1 Hepatitis C virus subtype 1b isolate HCV-S1, complete genome 1577_...c..a.............159685
AF511948.1 Hepatitis C virus isolate XF222 polyprotein-like gene, complete seque1577_.t..g...............159685
AY232738.1 Hepatitis C virus clone MD2b5-1 polyprotein mRNA, complete cds 1540_.t.a................155985
AY232739.1 Hepatitis C virus clone MD2b5-2 polyprotein mRNA, complete cds 1540_.t.a................155985
AY232744.1 Hepatitis C virus clone MD2b8-1 polyprotein mRNA, complete cds 1540_.t.............t....155985
AY232745.1 Hepatitis C virus clone MD2b8-2 polyprotein mRNA, complete cds 1540_.t.............t....155985
AB154179.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola1565_...t..a.............158485
AB154180.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola1565_...t..a.............158485
AB154181.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola1565_...c..a.............158485
AB154182.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola1565_...t..a.............158485
AB154183.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola1565_...t..a.............158485
AB154185.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola1565_...t..a.............158485
AB154186.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola1565_...t..a.............158485
AB154187.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola1565_...t..a.............158485
AB154189.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola1565_...t..a.............158485
AB154191.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola1565_...t..a.............158485
AB154192.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola1565_...t..a.............158485
AB154194.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola1565_...t..a.............158485
AB154199.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola1565_...t..a.............158485
AB154200.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola1565_...t..a.............158485
AB154203.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola1565_...t..a.............158485
AB154204.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola1565_...t..a.............158485
AB154206.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola1565_...t..a.............158485
DQ155561.1 Hepatitis C virus (isolate D54) polyprotein gene, partial cds 1549_...c...........t....156885
AJ851228.1 Hepatitis C virus gene for polyprotein, genomic RNA, isolate Equatori1550_...c...........t....156985
DQ480513.1 Hepatitis C virus subtype 6a strain 6a35, complete genome 1531_...c...........t....155085
EF026073.1 Hepatitis C virus strain RF3 2/5 polyprotein mRNA, partial cds 1554_...c..........g.....157385
EF032886.1 Hepatitis C virus subtype 1a isolate BR601 polyprotein gene, complete1504_....g.....t.........152385
EF032887.1 Hepatitis C virus subtype 1a isolate BR554_P1_5.23.03 polyprotein gen1511_....g.....t.........153085
EF032888.1 Hepatitis C virus subtype 1a isolate BR554_P10_10.21.03 polyprotein g1499_....g.....t.........151885
EF032889.1 Hepatitis C virus subtype 1a isolate BR554_P16_6.24.04 polyprotein ge1483_....g.....t.........150285
EF032890.1 Hepatitis C virus subtype 1a isolate BR554_P17_10.21.04 polyprotein g1497_....g.....t.........151685
AB249644.1 Hepatitis C virus subtype 1b genomic RNA, complete genome, hiroshima 1577_...t..a.............159685
AM408911.1 Hepatitis C virus partial gene for polyprotein, recombinant 2/5, geno1554_...c..........g.....157385
EF407415.1 Hepatitis C virus isolate 3018 polyprotein gene, complete cds 1527_..............gt....154685
EF407419.1 Hepatitis C virus isolate 5003 polyprotein gene, complete cds 1528_......t...t.........154785
EF407433.1 Hepatitis C virus isolate 7046 polyprotein gene, complete cds 1528_......t..t..........154785
EF407446.1 Hepatitis C virus isolate 8009 polyprotein gene, complete cds 1498_....g.........g.....151785
EF407460.1 Hepatitis C virus isolate 8007 polyprotein gene, complete cds 1527_...c..a.............154685
EF407461.1 Hepatitis C virus isolate 5004 polyprotein gene, complete cds 1557_...c..a.............157685
EF407465.1 Hepatitis C virus isolate 6017 polyprotein gene, complete cds 1522_...t..a.............154185
EF407469.1 Hepatitis C virus isolate 4014 polyprotein gene, complete cds 1521_...t..a.............154085
EF407470.1 Hepatitis C virus isolate 4064 polyprotein gene, complete cds 1529_...t..a.............154885
EF407471.1 Hepatitis C virus isolate 5044 polyprotein gene, complete cds 1522_...t..a.............154185
EF407472.1 Hepatitis C virus isolate 4034 polyprotein gene, complete cds 1523_...t..a.............154285
EF407479.1 Hepatitis C virus isolate 4036 polyprotein gene, complete cds 1522_...c..a.............154185
EF407480.1 Hepatitis C virus isolate 3043 polyprotein gene, complete cds 1524_...t..a.............154385
EF407485.1 Hepatitis C virus isolate 7026 polyprotein gene, complete cds 1532_...c..a.............155185
EF407487.1 Hepatitis C virus isolate 6057 polyprotein gene, complete cds 1524_...c..a.............154385
EF407497.1 Hepatitis C virus isolate 5002 polyprotein gene, complete cds 1521_...t..a.............154085
EF407501.1 Hepatitis C virus isolate 7055 polyprotein gene, complete cds 1550_......a..t..........156985
EU155241.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V71/2002, complete1473_....g.t.............149285
EU155345.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V221/2002, complet1485_...a.........g......150485
EU155350.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V256/2003, complet1458_...ag...............147785
EU246930.1 Hepatitis C virus strain D9 polyprotein gene, complete cds 1549_...c...........a....156885
EU246935.1 Hepatitis C virus strain TH24 polyprotein gene, complete cds 1515_...c...........t....153485
EU362885.1 Hepatitis C virus isolate 5009_FU24 polyprotein (pol) gene, partial c1495_....g.............t.151485
EU362896.1 Hepatitis C virus isolate 7046_FU24 polyprotein (pol) gene, complete 1536_......t..t..........155585
EU234062.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V135/1992, complet1525_...c..a.............154485
EU155223.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V151/2002, complet1531_...t..a.............155085
EU155225.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V155/2003, complet1526_...t..a.............154585
EU155226.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V156/2004, complet1525_...c..a.............154485
EU155227.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V157/2003, complet1525_...t..a.............154485
EU155229.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V159/2004, complet1525_...c..a.............154485
EU155237.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V457/2006, complet1518_....g.t.............153785
EU155238.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V465/2007, complet1503_...a.c..............152285
EU482836.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V506/2002, complet1508_..........g....t....152785
EU482845.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V438/2006, complet1510_....g.....g.........152985
EU482846.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V439/2000, complet1507_...ag...............152685
EU482849.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V138/1989, complet1525_...c..a.............154485
EU482873.1 Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V28/2003, complete1488_..........t.t.......150785
EU482874.1 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V287/2005, complet1528_...t..a.............154785
EU482875.1 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V310/2005, complet1525_...c..a.............154485
EU482879.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V372/2006, complet1528_...t..a.............154785
EU482883.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V153/2005, complet1528_...t..a.............154785
EU482886.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V458/2006, complet1529_...t..a.............154885
EU155253.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V363/2006, complet1525_...t..a.............154485
EU155255.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V366/2006, complet1525_...c..a.............154485
EU155262.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V381/2001, complet1525_...c..a.............154485
EU155264.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V385/2006, complet1503_...t..a.............152285
EU155297.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V333/2002, complet1493_...a..........g.....151285
EU155300.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V341/2003, complet1524_...t..a.............154385
EU155301.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V344/2001, complet1525_...t..a.............154485
EU155302.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V345/2001, complet1525_...c..a.............154485
EU155304.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V347/2003, complet1254_...t..a.............127385
EU155305.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V350/2002, complet1525_...c..a.............154485
EU155315.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V416/2001, complet1525_...c..a.............154485
EU155316.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V419/2002, complet1525_...c..a.............154485
EU155318.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V421/2005, complet1525_...t..a.............154485
EU155324.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V121/1992, complet1525_...t..a.............154485
EU155326.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V124/1992, complet1525_...t..a.............154485
EU155330.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V130/1994, complet1547_...t..a.............156685
EU155331.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V131/1990, complet1525_...c..a.............154485
EU155332.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V132/1996, complet1525_...t..a.............154485
EU155346.2 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V236/2005, complet1499_....g..........t....151885
EU155348.2 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V240/2005, complet1486_...a...........t....150585
EU155351.2 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V257/2003, complet1498_....g.g.............151785
EU155352.2 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V262/2004, complet1503_...a..g.............152285
EU155356.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V273/2003, complet1525_...t..a.............154485
EU155364.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V288/2006, complet1525_...t..a.............154485
EU155366.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V294/2002, complet1525_...c..a.............154485
EU155369.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V297/2002, complet1525_...c..t.............154485
AB426117.1 Hepatitis C virus subtype 1b genomic RNA, complete genome, hiroshima 1577_...t..a.............159685
EU529676.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V39/2004, complete1509_..........t....t....152885
AB435162.2 Hepatitis C virus subtype 1b genomic RNA, complete genome, hiroshima 1577_...t..a.............159685
EU660385.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V258/2003, complet1486_...a...........t....150585
EU660386.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V355/2006, complet1525_...t..a.............154485
EU255928.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V231/2003, complet1503_....g.g.............152285
EU255930.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V237/2005, complet1503_....g.....g.........152285
EU255943.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V223/2003, complet1496_...a..........g.....151585
EU255952.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V247/2005, complet1498_...........g..g.....151785
EU255956.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V259/2003, complet1504_....g.............t.152385
EU256059.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V220/2005, complet1525_...t..a.............154485
EU256061.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V364/2006, complet1525_...c..a.............154485
EU256065.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V377/2006, complet1525_...t..a.............154485
EU256067.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V402/2006, complet1504_.t..........t.......152385
EU256068.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V405/2006, complet1497_...c...........t....151685
EU256088.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V149/2003, complet1525_...t..a.............154485
EU256089.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V161/2002, complet1525_...t..a.............154485
EU256098.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V343/2002, complet1525_...t..a.............154485
EU256100.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V349/2002, complet1525_...c..a.............154485
EU256102.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V415/2001, complet1525_...t..a.............154485
EU256105.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V505/2001, complet1527_......t.g...........154685
EU256106.1 Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V32/2004, complete1495_..........t....t....151485
EU155347.2 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V239/2005, complet1488_....g.........g.....150785
EU256000.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V143/2003, complet1525_...t..a.............154485
EU256005.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V451/2006, complet1505_..........t....t....152485
EU256007.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V464/2006, complet1493_......tc............151285
EU256027.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V83/2003, complete1510_....g.....t.........152985
EU256037.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V98/2004, complete1510_....g....t..........152985
EU256040.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V18/2004, complete1503_.........at.........152285
EU256045.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V380/2003, complet1525_...t..a.............154485
EU256072.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V238/2005, complet1484_...a..t.............150385
EU256074.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V264/2005, complet1501_..........t....t....152085
EU256076.1 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V280/2004, complet1525_...t..a.............154485
EU255961.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V137/1991, complet1525_...t..a.............154485
EU255962.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V140/1991, complet1243_...c..a.............126285
EU255968.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V173/1989, complet1487_......t...t.........150685
EU255980.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V190/1990, complet1495_..........g.......t.151485
EU255992.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V213/1992, complet1498_...a..t.............151785
FJ024277.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1711/2007, comple1525_...t..a.............154485
FJ024279.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1715/2007, comple1525_...c..a.............154485
EU862827.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V218/1993, partial1494_......t...t.........151385
FJ205869.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1720/2006, comple1471_...a.c..............149085
FJ390396.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1748/2007, comple1525_...t..a.............154485
FJ478453.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V2148/1999, comple1525_...t..a.............154485
GQ149768.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V2147/2002, comple1488_...a...........t....150785
GU133617.1 Hepatitis C virus subtype 1b, complete genome 1577_...t..a.............159685
DQ835765.1 Hepatitis C virus subtype 6m isolate C-0185, complete genome 1571_......t.r......y....159080
EU155329.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V128/1992, complet1524....tg.g.............154485
Y12083.1 Hepatitis C virus genotype 6a RNA for HCV polyprotein 1517__..c...........t....153580
AF165047.1 Hepatitis C virus subtype 1b strain MD2-1, complete genome 1566__..t..t.............158480
AF165048.1 Hepatitis C virus subtype 1b strain MD2-2, complete genome 1566__..t..t.............158480
AB049087.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT051547__..c..a.............156580
AB049090.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT141547__..t..a.............156580
AY232746.1 Hepatitis C virus clone MD2b9-1 polyprotein mRNA, complete cds 1541__..a...........t....155980
AY232747.1 Hepatitis C virus clone MD2b9-2 polyprotein mRNA, complete cds 1541__..a...........t....155980
D84263.2 Hepatitis C virus (isolate VN235) genomic RNA, complete genome 1575__.....t...........g.159380
DQ437509.2 Hepatitis C virus isolate 452 polyprotein gene, partial cds 1236_....g..........t..._125480
DQ480512.1 Hepatitis C virus subtype 6a strain 6a77, complete genome 1532__..t...........t....155080
DQ480516.1 Hepatitis C virus subtype 6a strain 6a61, complete genome 1532__..c...........t....155080
DQ480518.1 Hepatitis C virus subtype 6a strain 6a65, complete genome 1532__..t...........t....155080
DQ480519.1 Hepatitis C virus subtype 6a strain 6a66, complete genome 1532__..c...........t....155080
DQ480520.1 Hepatitis C virus subtype 6a strain 6a67, complete genome 1532__..c...........t....155080
DQ480522.1 Hepatitis C virus subtype 6a strain 6a72, complete genome 1532__..c...........t....155080
DQ480524.1 Hepatitis C virus subtype 6a strain 6a74, complete genome 1535__..c...........t....155380
DQ988076.1 Hepatitis C virus isolate Eg7 polyprotein gene, partial cds 1495_...c...m..........r.151480
EF407447.1 Hepatitis C virus isolate 8004 polyprotein gene, complete cds 1538__.............gt....155680
EF407476.1 Hepatitis C virus isolate 3012 polyprotein gene, complete cds 1513__..t..a.............153180
EU482848.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V9/2005, complete 1480__...g.............t.149880
EU482888.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V123/1992, complet1529__..t..a.............154780
EU155288.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V322/2002, complet1495__...g.....g.........151380
EU155317.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V420/2002, complet1526__..c..a.............154480
EU256084.1 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V303/2003, complet1526__..t..a.............154480
EU862835.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V509/2001, partial1526__..t..t.............154480
AB442220.1 Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: KAH1578__..c..a.............159680
EU862832.1 Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V27/2003, complete1492__...g.....t.........151080
D17763.1HPCEGS Hepatitis C virus (isolate NZL1) genomic RNA, complete genome 1575_....g..........t..._159380
D14853.1HPCCGS Hepatitis C virus (isolate HC-G9) genomic RNA, complete genome 1577_...c..a..t..........159680
U45476.1HCU45476 Hepatitis C virus isolate HD-1, complete genome 1577_...cg.a.............159680
D50409.1 Hepatitis C virus (isolate BEBE1) genomic RNA, complete genome 1576_...c...c..........a.159580
AJ000009.1 Hepatitis C virus complete genome sequence 1560_...tg.a.............157980
AJ238799.1 Hepatitis C virus type 1b complete genome, isolate Con1 1577_...tg.a.............159680
AF176573.1 Hepatitis C virus subtype 1b strain 274933RU, complete genome 1577_...c..a..t..........159680
AJ238800.1 Hepatitis C virus type 1b complete genome, isolate NC1 1236_...tg.a.............125580
AF238486.1 Hepatitis C virus subtype 2b strain MD2b-1, complete genome 1540_.t.a...........t....155980
AF207752.1 Hepatitis C virus subtype 1b strain MD11, complete genome 1565_...c..a..a..........158480
AF207760.1 Hepatitis C virus subtype 1b strain MD19, complete genome 1565_...t..a...........t.158480
AF207762.1 Hepatitis C virus subtype 1b strain MD21, complete genome 1565_...t..at............158480
AY045702.1 Hepatitis C virus isolate HCR6, complete genome 1579_...c..a...........t.159880
AY232730.1 Hepatitis C virus clone MD2b1-1 polyprotein mRNA, complete cds 1540_.t.a...........t....155980
AB154177.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola1565_...tg.a.............158480
AB154178.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola1565_...tg.a.............158480
AB154190.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola1565_...tg.a.............158480
AB154198.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola1565_...tg.a.............158480
AB154201.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola1565_...t..g..t..........158480
DQ314806.1 Hepatitis C virus subtype 6g isolate HK6554, complete genome 1571_...tg.............a.159080
DQ418786.1 Hepatitis C virus subtype 4d isolate 03-18 polyprotein gene, complete1470_...c...........t..g.148980
DQ516083.1 Hepatitis C virus subtype 4d isolate 24 polyprotein gene, complete cd1515_...c..t...........g.153480
EF424629.1 Hepatitis C virus subtype 6c isolate Th846, complete genome 1572_...tg.............a.159180
EF407428.1 Hepatitis C virus isolate 1024 polyprotein gene, complete cds 1483_..........t.t.....t.150280
EF407443.1 Hepatitis C virus isolate 7024 polyprotein gene, complete cds 1537_.t..g....t..........155680
EF407475.1 Hepatitis C virus isolate 3009 polyprotein gene, complete cds 1509_...tg.g.............152880
EF407483.1 Hepatitis C virus isolate 4043 polyprotein gene, complete cds 1552_...tg.a.............157180
EF407492.1 Hepatitis C virus isolate 7025 polyprotein gene, complete cds 1517_...tg.a.............153680
EF407493.1 Hepatitis C virus isolate 3031 polyprotein gene, complete cds 1532_...tg.g.............155180
EF407502.1 Hepatitis C virus isolate 2038 polyprotein gene, complete cds 1606_...t..a..t..........162580
EF589160.1 Hepatitis C virus subtype 4f strain IFBT84 polyprotein gene, partial 1511_...t...........t..g.153080
EF589161.1 Hepatitis C virus subtype 4f strain IFBT88 polyprotein gene, partial 1510_...c...........t..a.152980
EU234061.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V126/1991, complet1525_...tg.a.............154480
EU155217.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V142/2004, complet1525_...a..a...t.........154480
EU155220.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V147/2004, complet1511_...tg.a.............153080
EU155221.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V148/2004, complet1525_...t..a..t..........154480
EU155234.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V447/2006, complet1526_...tg.a.............154580
EU155235.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V449/2006, complet1525_...tg.a.............154480
EU482839.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V370/2006, complet1525_...tg.a.............154480
EU482877.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V342/2001, complet1531_...tg.a.............155080
EU482881.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V383/2003, complet1528_...tg.g.............154780
EU482885.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V448/2006, complet1528_...tg.a.............154780
EU155256.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V367/2006, complet1525_...tg.g.............154480
EU155257.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V369/2006, complet1525_...tg.a.............154480
EU155259.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V374/2006, complet1525_...tg.g.............154480
EU155260.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V375/2006, complet1525_...tg.a.............154480
EU155281.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V512/2005, complet1525_...tg.g.............154480
EU155282.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V696/2006, complet1494_....g..c..g.........151380
EU155303.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V346/2001, complet1525_...tg.a.............154480
EU155325.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V122/1991, complet1525_...tg.a.............154480
EU155328.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V127/1992, complet1525_...cg.a.............154480
EU155333.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V133/1989, complet1514_...tg.a.............153380
EU155334.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V134/1990, complet1525_...tg.a.............154480
EU155358.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V276/2004, complet1525_...tg.a.............154480
EU155360.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V278/2003, complet1525_...cg.a.............154480
EU155361.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V281/2004, complet1525_...tg.a.............154480
EU155368.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V296/2001, complet1525_...tg.a.............154480
EU155372.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V306/2004, complet1525_...tg.g.............154480
EU529682.1 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V291/2002, complet1243_...c..a..t..........126280
EU660388.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V154/2001, complet1526_...tg.a.............154580
EU255960.1 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V312/2006, complet1525_...t..a..t..........154480
EU256064.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V376/2006, complet1525_...tg.a.............154480
EU256092.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V463/2006, complet1525_...cg.a.............154480
EU255993.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V102/2004, complet1503_...........gt..t....152280
EU256001.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V144/2002, complet1525_...tg.a.............154480
EU256054.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V443/2001, complet1525_...tg.a.............154480
EU256075.1 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V279/2004, complet1525_...tg.g.............154480
EU256077.1 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V283/2005, complet1525_...tg.a.............154480
EU256078.1 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V284/2005, complet1527_...t..a..t..........154680
EU256081.1 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V293/2002, complet1525_...tg.a.............154480
EU256082.1 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V298/2005, complet1526_...tg.a.............154580
EU256085.1 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V305/2003, complet1525_...t..a..t..........154480
FJ390397.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1749/2008, comple1525_...cg.a.............154480
FJ390398.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1750/2008, comple1525_...tg.a.............154480
FJ025855.1 Hepatitis C virus strain P212 polyprotein gene, complete cds 1426_...c..t...........g.144580
FJ025856.1 Hepatitis C virus strain P245 polyprotein gene, complete cds 1426_...c...t..........g.144580
FJ462433.1 Hepatitis C virus isolate QC249, complete genome 1577_...cg.............g.159680
FJ462434.1 Hepatitis C virus isolate QC262, complete genome 1577_...c...........t..a.159680
FJ462434.1 Hepatitis C virus isolate QC262, complete genome 2589__..........t...t.___260466
FJ462435.1 Hepatitis C virus isolate QC264, complete genome 1576_...cg....t..........159580
FJ462435.1 Hepatitis C virus isolate QC264, complete genome 8882..g.c..........ttc...886276
FJ462436.1 Hepatitis C virus isolate QC381, complete genome 1576_...c..t...........r.159580
FJ462437.1 Hepatitis C virus isolate QC382, complete genome 1576_...c..t...........g.159580
FJ462438.1 Hepatitis C virus isolate QC383, complete genome 1577_...a..t...........g.159680
FN435993.1 Hepatitis C virus subtype 1b complete genome, isolate EU1, genomic RN1578_...tg.a.............159780
EU862836.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V244/2003, complet1503_....g.t...t.........152280
EU862837.1 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V304/2004, complet1532_...t..a...........t.155180
D10988.1HPCJ8G Hepatitis C virus genome 1579___.a...........t....159676
D28917.1HPCK3A Hepatitis C virus (isolate HCV-K3a/650) genomic RNA, complete g1576__...........t..t..._159376
AF169003.1 Hepatitis C virus subtype 2a isolate G2aK1, complete genome 1574__..c..t........y....159276
AB030907.1 Hepatitis C virus (isolate JPUT971017) genomic RNA, complete genome 1579___.a.....t..........159676
AY232734.1 Hepatitis C virus clone MD2b3-1 polyprotein mRNA, complete cds 1542___.a...........t....155976
AY232735.1 Hepatitis C virus clone MD2b3-2 polyprotein mRNA, complete cds 1542___.a...........t....155976
X61596.1 Hepatitis C virus core, E1, NS1/E2, NS2, NS3, NS4a, NS4b and NS5 gene1561__..tg.t.............157976
D90208.1HPCJCG Hepatitis C virus ORF gene, complete cds 1566__..cg.g.............158476
D89872.1 Hepatitis C virus RNA for polyprotein, complete cds 1237__..cg.g.............125576
AF165055.1 Hepatitis C virus subtype 1b strain MD6-1, complete genome 1575__..tg.t.............159376
AF165056.1 Hepatitis C virus subtype 1b strain MD6-2, complete genome 1575__..tg.t.............159376
AF165063.1 Hepatitis C virus subtype 1b strain MD10-1, complete genome 1566__..tg.a.............158476
AF165064.1 Hepatitis C virus subtype 1b strain MD10-2, complete genome 1566__..tg.a.............158476
AB031663.1 Hepatitis C virus (isolate VAT96) genomic RNA, complete genome 1578__..tg.t.............159676
AF207768.1 Hepatitis C virus subtype 1b strain MD27, complete genome 1566__..t..a..g..........158476
AB049092.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT141547__..t..a..t..........156576
AB049096.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT191547__..t..a..t..........156576
AB049099.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT211578__..tg.g.............159676
AF333324.1 Hepatitis C virus type 1b polyprotein mRNA, complete cds 1578__..cg.g.............159676
DQ480521.1 Hepatitis C virus subtype 6a strain 6a69, complete genome 1532__..t...........t..t.155076
DQ480523.1 Hepatitis C virus subtype 6a strain 6a62, complete genome 1532__..c...........t..t.155076
DQ835762.1 Hepatitis C virus subtype 6i isolate C-0159, complete genome 1574_...t..t...t....y....159376
EU155228.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V158/2003, complet1526__..tg.a.............154476
EU155337.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V141/1990, complet1526__..tg.a.............154476
FJ839870.1 Hepatitis C virus isolate QC274, complete genome 1577__...g..........t..g.159576
D63821.1HPCJK049E1 Hepatitis C virus (isolate JK049) genomic RNA, complete gen1577___..g....t........._159371
AB047642.1 Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-3 2834..g............g.____281871
D13558.1HPCJ483 Hepatitis C virus genome, complete sequence 1577_...tg.g..t..........159676
D10750.1HPCJ491 Hepatitis C virus genome, complete sequence 1577_...tg.g..t..........159676
D50485.1HPCK1S2 Hepatitis C virus (strain HCV-1b, clone HCV-K1-S2), complete g1565_...tg.g..t..........158476
D50481.1HPCK1R2 Hepatitis C virus (strain HCV-1b, clone HCV-K1-R2), complete g1565_...tg.g..t..........158476
AF054247.1 Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L6S, complete1577_...tg.g..t..........159676
AF054248.1 Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L2S, complete1577_...tg.g..t..........159676
AF054249.1 Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L4S, complete1578_...tg.g..t..........159776
AF054250.1 Hepatitis C virus subtype 1b strain HC-J4, complete genome 1567_...tg.g..t..........158676
AF165053.1 Hepatitis C virus subtype 1b strain MD5-1, complete genome 1565_...cg.a...t.........158476
AF165054.1 Hepatitis C virus subtype 1b strain MD5-2, complete genome 1565_...cg.a...t.........158476
AF207765.1 Hepatitis C virus subtype 1b strain MD24, complete genome 1565_...tg.g...t.........158476
AF483269.1 Hepatitis C virus type 1b isolate HCV-TR1 from Turkey, complete genom1542_...tg.a...........t.156176
AB154202.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola1565_...cg.g..t..........158476
AY878650.1 Hepatitis C virus subtype 6k isolate KM45, complete genome 1557_.t....t..tt.........157676
AY878651.1 Hepatitis C virus subtype 6k isolate KM41, complete genome 1542_.t....tt.t..........156176
AY878651.1 Hepatitis C virus subtype 6k isolate KM41, complete genome 8863..g.c..........tgc...884376
DQ278891.1 Hepatitis C virus subtype 6k isolate KM45, complete genome 1573_.t....t..tt.........159276
DQ278893.1 Hepatitis C virus subtype 6k isolate KM41, complete genome 1574_.t....tt.t..........159376
DQ278893.1 Hepatitis C virus subtype 6k isolate KM41, complete genome 8895..g.c..........tgc...887576
EF407448.1 Hepatitis C virus isolate 6018 polyprotein gene, partial cds 1537_...a.........gga....155676
EF407504.1 Hepatitis C virus isolate 8069 polyprotein gene, complete cds 1531_...tg.g...........t.155076
EU155218.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V145/2005, complet1526_...tg.a..t..........154576
EU155219.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V146/2002, complet1525_...tg.g...t.........154476
EU155222.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V150/2004, complet1525_...tg.a...t.........154476
EU155224.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V152/2003, complet1525_...t..a..tt.........154476
EU155306.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V352/2002, complet1525_...tg.a..t..........154476
EU155357.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V275/2003, complet1525_...cg.g...t.........154476
EU155365.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V289/2006, complet1525_...tg.a..t..........154476
EU255941.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V697/2006, complet1509_...ag....tt.........152876
EU643835.1 Hepatitis C virus isolate HCV-6-D177 polyprotein gene, complete cds 1301_.t.a.....tg.........132076
AY232742.1 Hepatitis C virus clone MD2b7-1 polyprotein mRNA, complete cds 1542___.a...........t..t.155971
AY232743.1 Hepatitis C virus clone MD2b7-2 polyprotein mRNA, complete cds 1542___.a...........t..t.155971
EF632071.1 Hepatitis C virus isolate VT21, complete genome 8878___.c..........t.c...886171
FJ407092.1 Hepatitis C virus isolate IND-HCV-3i, complete genome 1576_.t..g..........t..__159371
DQ418788.1 Hepatitis C virus subtype 4a isolate F7157 polyprotein gene, complete2513__..........t...t.___252866
FJ839869.1 Hepatitis C virus isolate QC155, complete genome 2591__..........t...t.___260666
EU158186.1 Hepatitis C virus isolate NK46, complete genome 3953______.........c...._396661
EU798761.1 Hepatitis C virus subtype 6v isolate KM046 polyprotein precursor, gen3953______.........c...._396661
FJ462439.1 Hepatitis C virus isolate QC384, complete genome 985.........t...atc.t...100576